| CollegeHighway.com Login |
| Don't have an account yet? You can create one. As registered user you have some advantages like theme manager, comments configuration and post comments with your name. |
| Trippin? |
 |
| Check Yourself |
 |
| Ephemerids |
One Day like Today...
|
| Welcome |
| You are Anonymous user. You can register for free by clicking here. |
 |
|
| Introduction | | Introduction You just clicked into the coolest place to get all your college news and information about college life. Looking to join the CollegeHighway crew? Click here. | |
| |
| VT Lottery Gimme 5, Pick 3 results for June 25, 2026 |
| Posted on Friday, June 26 @ 00:02:41 PDT (6 reads) | |
|
Vermont
vt lottery gimme 5, pick 3 results for june 25, 2026
powerball, mega millions jackpots: what to know in case you win
here’s what to know in case you win the powerball or mega millions jackpot.
just the faqs, usa today
the vermont lottery offers several draw games for those willing to make a bet to win big.
those who want to play can enter the megabucks and lucky for life games as well as the national powerball and mega millions games. Vermont also partners with new hampshire and maine for the tri-state lottery, which includes the mega bucks, gimme 5 as well as the pick 3 and pick 4.
drawings are held at regular days and times, check the end of this story to see the schedule.
here’s a look at june 25, 2026, results for each game:
winning gimme 5 numbers from june 25 drawing
13-14-18-21-22
check gimme 5 payouts and previous drawings here.
winning pick 3 numbers from june 25 drawing
day: 2-1-4
evening: 0-7-1
check pick 3 payouts and previous drawings here.
winning pick 4 numbers from june 25 drawing
day: 5-4-4-9
evening: 5-5-1-1
check pick 4 payouts and previous drawings here.
winning millionaire for life numbers from june 25 drawing
03-13-14-34-45, bonus: 01
check millionaire for life payouts and previous drawings here.
feeling lucky? Explore the latest lottery news & results
are you a winner? Here’s how to claim your lottery prize
for vermont lottery prizes up to $499, winners can claim their prize at any authorized vermont lottery retailer or at the vermont lottery headquarters by presenting the signed winning ticket for validation. Prizes between $500 and $5,000 can be claimed at any m&t bank location in vermont during the vermont lottery office’s business hours, which are 8a.M.-4p.M. Monday through friday, except state holidays.
for prizes over $5,000, claims must be made in person at the vermont lottery headquarters. In addition to signing your ticket, you will need to bring a government-issued photo id, and a completed claim form.
all prize claims must be submitted within one year of the drawing date. For more information on prize claims or to download a vermont lottery claim form, visit the vermont lottery’s faq page or contact their customer service line at (802) 479-5686.
vermont lottery headquarters
1311 us route 302, suite 100
barre, vt
05641
when are the vermont lottery drawings held?
- powerball: 10:59 p.M. Monday, wednesday, and saturday.
- mega millions: 11 p.M. Tuesday and friday.
- gimme 5: 6:55 p.M. Monday through friday.
- lucky for life: 10:38 p.M. Daily.
- pick 3 day: 1:10 p.M. Daily.
- pick 4 day: 1:10 p.M. Daily.
- pick 3 evening: 6:55 p.M. Daily.
- pick 4 evening: 6:55 p.M. Daily.
- megabucks: 7:59 p.M. Monday, wednesday and saturday.
- millionaire for life: 11:15 p.M. Daily
what is vermont lottery second chance?
vermont’s 2nd chance lottery lets players enter eligible non-winning instant scratch tickets into a drawing to win cash and/or other prizes. Players must register through the state’s official lottery website or app. The drawings are held quarterly or are part of an additional promotion, and are done at pollard banknote limited in winnipeg, mb, canada.
this results page was generated automatically using information from tinbu and a template written and reviewed by a vermont editor. You can send feedback using this form.
vermont
record-setting cvu runner named vermont’s top girls track and field athlete by gatorade
champlain valley senior zoey mcnabb has been named the vermont high school girls track and field athlete for the 2026 season, gatorade announced thursday, june 25.
the gatorade award recognizes athletes for their on-field success, high academic achievement and exemplary character.
in her first year as a competitive runner, the 5-foot-7 mcnabb broke long-held state records in the 1500- and 3000-meter races this past spring with times of 4 minutes, 28.59 seconds and 9:24.58, respectively. At the division i state meet, she swept both events to help the redhawks claim a team championship three-peat.
her 3,000 time ranked fourth nationally; her 1,500 performance was good for 12th. At the new england championship meet, mcnabb took second in the 3,200 and third in the 1,600. She also ran in five events at new balance nationals, where she set the state record in the two mile.
an all-state basketball player for cvu, she has volunteered locally at the green mountain montessori school in essex in addition to donating her time as a youth basketball coach, according to the news release.
“zoey was fearless this spring, attacking decades-old records and destroying them,” bfa-st. Albans coach mike mashtare said in a statement. “What made her special was how effortless she made it look with her smooth stride and relaxed running style.”
mcnabb has maintained an unweighted 4.27 gpa in the classroom. She has signed a written letter of athletic aid to compete on scholarship at the university of vermont this fall.
as part of gatorade’s commitment to breaking down barriers in sport, every player of the year also receives a grant to donate to a social impact partner.
to learn more about the gatorade player of the year program, visit playeroftheyear.Gatorade.Com.
contact alex abrami at aabrami@freepressmedia.Com. Follow him on x, formerly known as twitter: @aabrami5.
vermont
experienced pros have vermont green women’s team on cusp of uslw playoffs
vermont green men’s team chris taylor praises team after home opener
vermont green men’s team head coach chris taylor talks with the media following the green’s home opener victory
the vermont green women’s team is predominantly a home for college players to play in a professional atmosphere during the summer. Yet there are a trio of seasoned overseas professional soccer players who are playing for the green this summer to help them find their next stop.
two members of that trio, defender chloe gorman and midfielder brenna connell, are both over the age of 30, playing with teammates nearly a decade younger while defender hannah kroupa graduated college in 2023. Yet, rather than taking time away from the pitch, they are spending the summer in vermont.
here’s why these professional soccer players opted to play for the green, a short two-month season where the players don’t get paid.
vermont green is a launching pad to finding a new team
all three players learned about the team the same way — the player’s network, which is a group to share opportunities and resources among female soccer players around the world. Head coach abby carchio sent out a message in the group publicizing the green. The trio all jumped on the opportunity.
both connell and gorman have spent the last few months training and thought the green was a great opportunity to get some minutes and film to help them sign with a new team later this summer.
“the desire of the club to truly provide a professional-level atmosphere and resources and the community is so behind the club, it seemed like a super unique opportunity,” connell said.
connell, gorman and kroupa are helping the green make history in their debut season. The green are currently one of eight undefeated teams still standing in the uslw with a 5-0-4 record.
gorman has had a crucial role, playing every minute in the green’s 10 games (which includes the maple cup) with she and kroupa anchoring the back line. That defense has only conceded six goals entering vermont’s final regular season game against new england mutiny on saturday, june 27.
kroupa and connell have appeared in a handful of games as well. The duo teamed up on a goal in vermont’s 2-0 maple cup victory, with kroupa earning the goal in her club debut. Both players have also contributed an assist in an official uslw match.
“i’m really thankful i have gotten a lot of minutes here especially after not being with a club for a year,” connell said. “It felt good to prove to myself that i can still do this and contribute a lot.”
the green can capture the northeast division title and earn a spot in the uslw playoffs with a win against mutiny on saturday, june 27.
vermont’s amateur status impresses the professional soccer trio
gorman, connell and kroupa have played all over the world, including stops in greece, hungary, israel, portugal and germany among other countries. The aspect that stands out to them is how ingrained vermont green is to the broader community.
“it means a bit more here,” gorman said. “It’s different to finish a game and have a 100 girls and parents come up to you and thank you, acknowledge that this is a big step in women’s sports.”
the organization takes great care of the players doing more than professional teams do. The team has found housing for everyone with kroupa, connell and gorman living together in college-style housing.
“playing abroad, it’s really hit or miss with what a club can provide for you,” kroupa said. “Even having someone do the laundry of training gear that you wouldn’t think about in college … simple stuff like that is such a big difference.”
the older players are also surrounded by some of the country’s top college players such as caitlin mara, brooke birtwistle, georgina clarke and olivia grenda.
the main difference between college soccer and a professional team has been honing in on the details and adding extra care to each decision.
“just being conscious of your play and decision making of the reasoning behind something and the cleanliness of the play,” gorman said.
besides serving as role models, the trio are helping vermont green remain feeling professional which is leading to results on the field of a winning club in year 1.
contact judith altneu at jaltneu@usatodayco.Com. Follow her on x, formerly known as twitter: @judith_altneu.
vermont
vermont attorney general will not prosecute state trooper who fatally shot unarmed putney man – vtdigger
vermont attorney general charity clark declined tuesday to prosecute a state police officer who shot and killed an unarmed man who was experiencing a mental health crisis last year.
vermont state police trooper peter romeo fatally shot 55-year-old scott garvey in his putney home on july 7, 2025. Romeo opened fire on garvey after police entered the man’s house, in which he had barricaded himself for more than four hours, according to a tuesday press release from the vermont attorney general’s office.
clark, the state’s top law enforcement officer, determined that police officers involved in the shooting did not violate state law by fatally shooting garvey, the press release said.
forty nine people have been shot by police officers in vermont since 1977, when the state began keeping track. None of those officers has been criminally prosecuted for their use of force, according to vermont state police data.
the vermont state police — whose officers were involved in the shooting — investigated the incident. Clark’s office reviewed the materials in the investigation before declining to press charges, according to the press release.
shawn garvey, scott’s brother, said in an interview wednesday that he believed his brother’s death was preventable and that police officers involved in the shooting made the wrong judgment calls.
“is the state going to hold anyone accountable at all? Or is this just a free ride, a free pass?” Shawn garvey said.
across the u.S., A quarter of police shootings between 2015 and 2020 involved someone with a mental illness, according to the national alliance on mental illness.
the press release from clark’s office sheds light on the timeline of events leading up to the fatal shooting.
the night of july 6, 2025, the day before garvey was killed, neighbors called the police to report seeing smoke coming from his apartment, the release said. Neighbors told police they believed he was trying to kill himself, according to the release.
when firefighters and emergency medical personnel responded, they reported that the smoke had come from a fire extinguisher. Garvey was alone in the apartment and not a threat, they said.
the next morning, at about 7:15 a.M., Garvey called police and reported he had been in an altercation with a neighbor the day before and he believed the neighbor had a firearm.
“mr. Garvey voiced concern that people were in the woods with guns, and that someone had tried to break into his house with a gun a few nights before, but he had stacked boxes in front of the door and fought them off,” the press release said, detailing garvey’s phone call.
later that morning, a neighbor of garvey’s called police to report that a man was banging on the windows and “stating that the voices are telling him to kill everyone.”
the press release said police officers and a mental health clinician arrived at garvey’s house at about 11:30 a.M. That morning. After talking to neighbors who witnessed garvey’s behavior and said they were scared, police spoke with garvey through his front door. Officers determined they had probable cause to arrest garvey, but he wouldn’t let them in.
“the embedded mental health clinician relayed that mr. Garvey ‘said he had a gun’ and ‘if he came out, you would have your guns drawn, and he would have his as well,’” the press release said.
police officers and the mental health clinician spent about four and a half hours communicating with garvey, trying to de-escalate the situation, the press release said, adding that officers were aware that garvey had a history of schizophrenia.
“throughout, mr. Garvey never denied that he was in possession of a firearm while in the apartment,” the press release said.
officers were eventually granted a warrant to enter the house and entered it at about 4:30 p.M. But when three troopers tried to enter the house, they encountered a barricade. Trooper romeo saw garvey holding an object that he wasn’t able to identify but suspected was a rifle, the press release said.
“when asked what he had seen by sergeant hughes, trooper romeo responded ‘i don’t know,’” the release said.
then police ordered garvey multiple times to drop the object, but he did not, according to the press release. It said garvey then raised the object like it was a rifle and pointed it at officers. Romeo fired seven shots, three of which hit garvey, the release said.
the object was not a rifle — it was a metal pole, the press release said. Garvey used the pole as a cane, his brother shawn said.
in the interview, shawn said that he thinks police officers escalated the situation by entering the house.
“my brother wasn’t hanging out the window with a weapon, he wasn’t threatening neighbors through their walls, he didn’t, you know, say he had a bomb,” he said.
shawn said he wasn’t surprised that the case wasn’t getting prosecuted, but it was difficult news to receive.
after his brother’s death, shawn said, he returned to his brother’s house to find a gruesome crime scene. He said the walls were filled with bullet holes and a pool of blood remained on the floor. Cleaning up the house, which his mother also lived in, cost about $20,000, he added.
then his family had to pay the state nearly $2,000 for his brother’s remains, he said.
“we’ve been living in a sort of purgatory for 351 days,” awaiting the results of the investigation, shawn said.
in response to shawn’s comments about officer conduct, clark said in an emailed statement to vtdigger that “this event was a tragedy. We cannot imagine the pain that the garvey family has endured and continues to experience, and our hearts go out to them during this time.”
before the attorney general made the public announcement, shawn said, he and his family members spent about four hours talking with police about the events leading up to his brother’s death.
“i came out more convinced than ever that my brother should still be alive today,” shawn said. |
( Read More... | 31914 bytes more | comments? |   ) |
| |
| Meet the 21 British players at Wimbledon: Its been a dream since I started playi |
| Posted on Friday, June 26 @ 00:02:41 PDT (10 reads) | |
|
|
Meet the 21 british players at wimbledon: ‘it’s been a dream since i started playing’
emma raducanu - 30th seed | age: 23 | world ranking: 32
former us open champion and british no 1. Reached the third round last year, losing to world no 1 aryna sabalenka in a thriller on centre court. Back working with coach andrew richardson, who was part of her team for her us open victory, and enjoyed a promising run to the queen’s final, though pre-wimbledon optimism has been dampened by reports of raducanu missing training sessions and wearing a protective boot.
katie boulter | age: 29 | wr: 59
bouncing back after a disappointing 2025 season, the former world no 23 reached the semi-finals at queen’s and secured the best win of her career by beating no 2 elena rybakina. Can play some of her best tennis on the grass, if she gets her aggressive style of play going. Yet to progress past the third round of a grand slam.
fran jones | age: 25 | wr: 103
the 25-year-old enjoyed a momentous first-round win at last month’s french open, for her first grand slam victory. Ahead of her fourth appearance at wimbledon, jones, who is from yorkshire but grew up in barcelona, does not want to be defined by her ectrodactyly ectodermal dysplasia, a genetic condition that means she only has three fingers and a thumb on each hand and seven toes across both feet. As a child, jones’ parents were told by doctors that she would not be able to play tennis. Now, her work-rate and dedication to improve shines through as jones aims to return to the world’s top 100, following a difficult year where she retired from the first-round of the australian open and suffered a freak gym accident in another scary injury set-back.
harriet dart - wildcard | age: 29 | wr: 151
at 29, dart will be making her eighth appearance in the wimbledon main draw. Now ranked 151st in singles, she stood up for great britain in april when, deprived of raducanu and boulter, she led anne keovathong’s side to an away victory against australia to qualify for the billie jean king cup finals. Dart won in both singles and doubles, and last week won her first tour-level title in doubles alongside maia lumsden to win the nottingham open.
alicia dudeney - wildcard | age: 23 | wr: 246
dudeney, 23, has climbed almost 900 ranking spots in the past year and will be making her wimbledon debut. Ranked 246 in the world, dudeney has won four titles on the world tennis tour (the level below the wta) this season, which included a 13-match winning streak between march and april. From hove, where she played at the same club as sonay kartal, she spent four years at the university of florida between 2021 and 2025.
hannah klugman - wildcard | age: 17 | wr: 412
has been signalled as one to watch ever since becoming the first british woman to win the orange bowl, a prestigious junior tournament in florida, as a 14-year-old in 2023. A us open girls’ semi-finalist last september, klugman, now 17, will be making her second appearance at wimbledon. Reached no 1 in the junior rankings before turning pro in january, and scored her first win on the wta by beating harriet dart in nottingham.
mika stojsavljevic - wildcard | age: 17 | wr: 276
the 17-year-old won the us open girls’ title in 2024, then reached the semi-finals in 2025, and will be making her second wimbledon main draw appearance after last year’s debut. Made a brilliant debut for great britain in the billie jean king cup qualifier away to australia where she upset talia gibson - an opponent ranked more than 200 places above her. The london-born stojsavljevic chose english literature and politics for her a-levels and studied while on tour.
katie swan - wildcard | age: 27 | wr: 196
after almost giving up tennis due to long-term injuries and losing her ranking, swan only began her comeback in april 2025 but will now be playing at wimbledon for the first time in three years. This will be the 27-year-old swan’s seventh wimbledon appearance and will feel extra special after battling from the brink of retirement to return to the world’s top 200.
mimi xu - wildcard | age: 18 | wr: 327
the swansea-born xu became the first welsh player to enter the wimbledon singles draw in 20 years when she played emma raducanu in the first round last year. At 18, xu has since won the biggest title of her career in front of her home crowd at the wrexham open, beating mika stojsavljevic in the final. Xu and stojsavljevic were runners-up in the 2024 wimbledon girls’ doubles.
cameron norrie - 26th seed | age: 30 | wr: 29
so often the last brit standing at grand slams, norrie retired from his first-round match at the french open, the just the second time in his professional career, while suffering with a rib injury but returned to queen’s and is set to be fit for wimbledon. A former semi-finalist at sw19, norrie, 30, returns as a seed after almost falling outside of the top-100 last year, finding form late in the season as he beat no 1 carlos alcaraz.
advertisement
jack draper | age: 24 | wr: 160
was seeded fourth at wimbledon 12 months ago after winning the biggest title of his career at indian wells but returns after a year of injury hell ranked outside the top 100. Struggles with an arm injury were followed by a knee injury, meaning the 24-year-old has only played nine matches this season before his comeback at eastbourne. But draper is back with a legend in his corner: new coach andy murray. “He’s bloody good,” was murray’s early assessment.
jan choinski | age: 30 | wr: 106
the german-born choinski, the son of an english ballet dancer, switched nationalities in 2019 and received his first wimbledon wildcard in 2023. After losing in the first round of qualifying last year, he returns to wimbledon as only the third male direct entrant. His run to the quarter-finals at eastbourne means he will reach a new career-high ranking of 100.
jacob fearnley - wildcard | age: 24 | wr: 152
after breaking into the top 50 after a rapid rise a couple of years ago, and taking a set off novak djokovic on centre court, backing up his breakthrough has been a struggle for the 24-year-old scot who can claim he beat both carlos alcaraz and jannik sinner in juniors. He’s won only two matches on tour during an injury-hit season and he has dropped out of the top 100.
arthur fery - wildcard | age: 23 | wr: 118
the 23-year-old is enjoying the season of his life after winning a match at the australian open as a qualifier and reaching the quarter-finals of queen’s in london. Born in france, his mother was a professional tennis player and his father, loic fery, is the owner of ligue 1 football club fc lorient.
felix gill - wildcard | age: 24 | wr: 220
making his wimbledon and grand slam debut at 24, the left-hander arrives at a career-high ranking of 220 after reaching his first challenger tour final in pune, india. His best results have come on clay, which is his favourite surface - unusual for a british player. He was also one win away from qualifying for the french open last month.
jack pinnington jones - wildcard | age: 23 | wr: 145
won on his wimbledon main draw debut last year, beating tomas martín etcheverry as a qualifier, and enjoyed a breakthrough run at the atp 250 tournament in dallas where he beat flavio cobolli to reach the quarter-finals. His run came close to texas christian university, where he followed in the footsteps of cameron norrie and jacob fearnley by enrolling at the horned frogs.
toby samuel - wildcard | age: 23 | wr: 142
enjoyed a rapid rise towards the end of 2025, winning 36 of 39 matches on the challenger tour, and carried that form into 2026 by qualifying for the main draw of a grand slam for the first time at the french open. His first-round defeat to seventh seed alex de minaur was his first tour-level match. The 23-year-old was previously doubles partners with athur fery, and they reached the boys’ doubles semi-finals at wimbledon in 2019.
harry wendelken - wildcard | age: 24 | wr: 203
the 24-year-old qualified for his first tour-level event on home soil at queen’s, beating two top-100 opponents in adam walton and aleksandar vukic in the process. It came after winning his first atp challenger event in greece last october, doing so as a lucky loser, as well as reaching three challenger finals since march. Arrives at his wimbledon and grand slam debut at a career-high ranking of 203 in the world.
max basing - qualifier | age: 23 | wr: 331
perhaps the cinderella story of the week. The 23-year-old, who trained at rafael nadal’s academy in manacor as a teenager, had previously lost in the first round of qualifying in atp challenger events at birmingham, ilkley and nottingham this grass-court season, as well as in the semi-finals of wimbledon’s pre-qualifying event. Granted a wildcard into wimbledon qualifying anyway, the world no 331 duly won three matches in a row reach the main draw of a grand slam for the first time. Basing’s five-set win over remy bertola also came just 10 weeks after tearing his hamstring. “Its been a dream of mine since ive started playing tennis,” he said.
billy harris - qualifier | age: 31 | wr: 140
the man in a van. Harris spent the early years of his life on the lower-rungs of the tennis tour living in a converted ford transit to save money, but made his big breakthrough in 2024 to qualify for wimbledon and reach his first grand slam main draw. Now 31, harris has qualified for wimbledon again and will made his third appearance in a row. Last year, he knocked out belgium’s zizou bergs to earn his first win.
oliver tarvet - qualifier | age: 22 | wr: 349
perhaps the underdog story of last year’s tournament last year, when - ranked 773 in the world - he qualified for wimbledon, won his first-round match, and faced carlos alcaraz on centre court. The 22-year-old tarvet has qualified again, and this time he can keep his prize money. Last year, tarvet was still a student at university of san diego, so couldn’t keep his £99,000 winnings due to ncaa rules. The good news is tarvet graduated from college last month, so can keep his earnings. |
| ( Read More... | 20288 bytes more | comments? | ) |
| |
| Meet the 21 British players at Wimbledon: Its been a dream since I started playi |
| Posted on Friday, June 26 @ 00:02:41 PDT (7 reads) | |
|
|
Story by meet the 21 british players at wimbledon: ‘it’s been a dream since i started playing’
oliver tarvet, the world no 349, qualified for wimbledon for the second consecutive year (pa archive) jamie braidwood fri, 26 june 2026 at 5:51 am utc · 10 min read emma raducanu - 30th seed | age: 23 | world ranking: 32
former us open champion and british no 1. Reached the third round last year, losing to world no 1 aryna sabalenka in a thriller on centre court. Back working with coach andrew richardson, who was part of her team for her us open victory, and enjoyed a promising run to the queen’s final , though pre-wimbledon optimism has been dampened by reports of raducanu missing training sessions and wearing a protective boot .
advertisement advertisement advertisement
emma raducanu leaving the practice courts ahead of the 2026 wimbledon championships at the all england lawn tennis and croquet club, london. Picture date: monday june 22, 2026. (Pa) katie boulter | age: 29 | wr: 59
bouncing back after a disappointing 2025 season, the former world no 23 reached the semi-finals at queen’s and secured the best win of her career by beating no 2 elena rybakina . Can play some of her best tennis on the grass, if she gets her aggressive style of play going. Yet to progress past the third round of a grand slam.
(getty) fran jones | age: 25 | wr: 103
the 25-year-old enjoyed a momentous first-round win at last month’s french open, for her first grand slam victory. Ahead of her fourth appearance at wimbledon, jones, who is from yorkshire but grew up in barcelona, does not want to be defined by her ectrodactyly ectodermal dysplasia, a genetic condition that means she only has three fingers and a thumb on each hand and seven toes across both feet. As a child, jones’ parents were told by doctors that she would not be able to play tennis. Now, her work-rate and dedication to improve shines through as jones aims to return to the world’s top 100, following a difficult year where she retired from the first-round of the australian open and suffered a freak gym accident in another scary injury set-back.
advertisement advertisement advertisement
(getty) harriet dart - wildcard | age: 29 | wr: 151
at 29, dart will be making her eighth appearance in the wimbledon main draw. Now ranked 151st in singles, she stood up for great britain in april when, deprived of raducanu and boulter, she led anne keovathong’s side to an away victory against australia to qualify for the billie jean king cup finals. Dart won in both singles and doubles, and last week won her first tour-level title in doubles alongside maia lumsden to win the nottingham open.
advertisement advertisement advertisement
(getty) alicia dudeney - wildcard | age: 23 | wr: 246
dudeney, 23, has climbed almost 900 ranking spots in the past year and will be making her wimbledon debut . Ranked 246 in the world, dudeney has won four titles on the world tennis tour (the level below the wta) this season, which included a 13-match winning streak between march and april. From hove, where she played at the same club as sonay kartal, she spent four years at the university of florida between 2021 and 2025.
advertisement advertisement advertisement
alicia dudeney will make her wimbledon debut next week (getty) hannah klugman - wildcard | age: 17 | wr: 412
has been signalled as one to watch ever since becoming the first british woman to win the orange bowl, a prestigious junior tournament in florida, as a 14-year-old in 2023. A us open girls’ semi-finalist last september, klugman, now 17, will be making her second appearance at wimbledon. Reached no 1 in the junior rankings before turning pro in january, and scored her first win on the wta by beating harriet dart in nottingham.
advertisement advertisement advertisement
(getty) mika stojsavljevic - wildcard | age: 17 | wr: 276
the 17-year-old won the us open girls’ title in 2024, then reached the semi-finals in 2025, and will be making her second wimbledon main draw appearance after last year’s debut. Made a brilliant debut for great britain in the billie jean king cup qualifier away to australia where she upset talia gibson - an opponent ranked more than 200 places above her. The london-born stojsavljevic chose english literature and politics for her a-levels and studied while on tour.
advertisement advertisement advertisement
(pa) katie swan - wildcard | age: 27 | wr: 196
after almost giving up tennis due to long-term injuries and losing her ranking , swan only began her comeback in april 2025 but will now be playing at wimbledon for the first time in three years. This will be the 27-year-old swan’s seventh wimbledon appearance and will feel extra special after battling from the brink of retirement to return to the world’s top 200.
katie swan plays at wimbledon in 2023 (adam davy/pa) (pa archive) mimi xu - wildcard | age: 18 | wr: 327
the swansea-born xu became the first welsh player to enter the wimbledon singles draw in 20 years when she played emma raducanu in the first round last year. At 18, xu has since won the biggest title of her career in front of her home crowd at the wrexham open, beating mika stojsavljevic in the final. Xu and stojsavljevic were runners-up in the 2024 wimbledon girls’ doubles.
advertisement advertisement advertisement
(getty) cameron norrie - 26th seed | age: 30 | wr: 29
so often the last brit standing at grand slams, norrie retired from his first-round match at the french open, the just the second time in his professional career, while suffering with a rib injury but returned to queen’s and is set to be fit for wimbledon. A former semi-finalist at sw19, norrie, 30, returns as a seed after almost falling outside of the top-100 last year, finding form late in the season as he beat no 1 carlos alcaraz.
advertisement advertisement advertisement
carlos alcaraz, left, ended cameron norrie’s impressive wimbledon run (mike egerton/pa) (pa wire) jack draper | age: 24 | wr: 160
was seeded fourth at wimbledon 12 months ago after winning the biggest title of his career at indian wells but returns after a year of injury hell ranked outside the top 100. Struggles with an arm injury were followed by a knee injury, meaning the 24-year-old has only played nine matches this season before his comeback at eastbourne. But draper is back with a legend in his corner: new coach andy murray. “He’s bloody good,” was murray’s early assessment.
advertisement advertisement advertisement
jack draper celebrates reaching the eastbourne semi-finals (steven paston/pa) (pa wire) jan choinski | age: 30 | wr: 106
the german-born choinski, the son of an english ballet dancer, switched nationalities in 2019 and received his first wimbledon wildcard in 2023. After losing in the first round of qualifying last year, he returns to wimbledon as only the third male direct entrant. His run to the quarter-finals at eastbourne means he will reach a new career-high ranking of 100.
(pa) jacob fearnley - wildcard | age: 24 | wr: 152
after breaking into the top 50 after a rapid rise a couple of years ago, and taking a set off novak djokovic on centre court, backing up his breakthrough has been a struggle for the 24-year-old scot who can claim he beat both carlos alcaraz and jannik sinner in juniors. He’s won only two matches on tour during an injury-hit season and he has dropped out of the top 100.
advertisement advertisement advertisement
(getty) arthur fery - wildcard | age: 23 | wr: 118
the 23-year-old is enjoying the season of his life after winning a match at the australian open as a qualifier and reaching the quarter-finals of queen’s in london . Born in france, his mother was a professional tennis player and his father, loic fery, is the owner of ligue 1 football club fc lorient.
arthur fery celebrates his victory (getty) felix gill - wildcard | age: 24 | wr: 220
making his wimbledon and grand slam debut at 24, the left-hander arrives at a career-high ranking of 220 after reaching his first challenger tour final in pune, india. His best results have come on clay, which is his favourite surface - unusual for a british player. He was also one win away from qualifying for the french open last month.
advertisement advertisement advertisement
(pa) jack pinnington jones - wildcard | age: 23 | wr: 145
won on his wimbledon main draw debut last year, beating tomas martín etcheverry as a qualifier, and enjoyed a breakthrough run at the atp 250 tournament in dallas where he beat flavio cobolli to reach the quarter-finals. His run came close to texas christian university, where he followed in the footsteps of cameron norrie and jacob fearnley by enrolling at the horned frogs.
(reuters) toby samuel - wildcard | age: 23 | wr: 142
enjoyed a rapid rise towards the end of 2025, winning 36 of 39 matches on the challenger tour, and carried that form into 2026 by qualifying for the main draw of a grand slam for the first time at the french open. His first-round defeat to seventh seed alex de minaur was his first tour-level match. The 23-year-old was previously doubles partners with athur fery, and they reached the boys’ doubles semi-finals at wimbledon in 2019.
advertisement advertisement advertisement
(getty) harry wendelken - wildcard | age: 24 | wr: 203
the 24-year-old qualified for his first tour-level event on home soil at queen’s, beating two top-100 opponents in adam walton and aleksandar vukic in the process. It came after winning his first atp challenger event in greece last october, doing so as a lucky loser, as well as reaching three challenger finals since march. Arrives at his wimbledon and grand slam debut at a career-high ranking of 203 in the world.
advertisement advertisement advertisement
(getty) max basing - qualifier | age: 23 | wr: 331
perhaps the cinderella story of the week . The 23-year-old, who trained at rafael nadal’s academy in manacor as a teenager, had previously lost in the first round of qualifying in atp challenger events at birmingham, ilkley and nottingham this grass-court season, as well as in the semi-finals of wimbledon’s pre-qualifying event. Granted a wildcard into wimbledon qualifying anyway, the world no 331 duly won three matches in a row reach the main draw of a grand slam for the first time. Basing’s five-set win over remy bertola also came just 10 weeks after tearing his hamstring. “Its been a dream of mine since ive started playing tennis,” he said.
advertisement advertisement advertisement
(getty) billy harris - qualifier | age: 31 | wr: 140
the man in a van. Harris spent the early years of his life on the lower-rungs of the tennis tour living in a converted ford transit to save money, but made his big breakthrough in 2024 to qualify for wimbledon and reach his first grand slam main draw. Now 31, harris has qualified for wimbledon again and will made his third appearance in a row. Last year, he knocked out belgium’s zizou bergs to earn his first win.
advertisement advertisement advertisement
(getty) oliver tarvet - qualifier | age: 22 | wr: 349
perhaps the underdog story of last year’s tournament last year, when - ranked 773 in the world - he qualified for wimbledon, won his first-round match, and faced carlos alcaraz on centre court . The 22-year-old tarvet has qualified again, and this time he can keep his prize money. Last year, tarvet was still a student at university of san diego, so couldn’t keep his £99,000 winnings due to ncaa rules. The good news is tarvet graduated from college last month, so can keep his earnings.
oliver tarvet celebrates winning his first-round match (jordan pettitt/pa) (pa archive) advertisement advertisement |
| ( Read More... | 23412 bytes more | comments? | ) |
| |
| Frontiers | miR-1248 enhances bortezomib-induced autophagy by targeting MEF2C/p3 |
| Posted on Friday, June 26 @ 00:02:41 PDT (6 reads) | |
|
|
Abstract
objective:
multiple myeloma (mm) is incurable and many patients respond poorly to bortezomib. New strategies to improve bortezomib sensitivity are needed.
methods:
we screened bortezomib-responsive mirnas by rna-seq in rpmi8226 cells (fold change >4, p<0.05). Mir-1248 was measured by qrt-pcr in mm cells and in plasma from 30 patients before/after vcd therapy. Mef2c was examined by qrt-pcr and western blot. A dual-luciferase reporter assay was performed to test mir-1248 binding to the mef2c 3?-Utr. After mir-1248 inhibitor transfection, we detected mef2c, p38 and autophagy markers by qrt-pcr/western blot and assessed autophagic activity by staining. Rescue experiments overexpressed mef2c. In vivo, a xenograft model (n=6) was used to detect these markers after mir-1248 inhibition plus bortezomib(0.5 mg/kg).
results:
bortezomib increased mir-1248 by 2-fold (p<0.05) and reduced mef2c mrna by 62% and protein by 55% (both p<0.01). Plasma mir-1248 also rose after vcd therapy (median 2.1-fold, p<0.05). Luciferase assays confirmed direct targeting of the mef2c 3?-Utr by mir-1248. Inhibiting mir-1248 reduced bortezomib-induced autophagy markers and staining, and partially restored mef2c and p38 (p<0.05). Mef2c overexpression weakened bortezomib-induced apoptosis (cell viability rose from 42 ± 5% to 71 ± 6%, p<0.01) and suppressed those markers. In xenografts, mir-1248 knockdown cut tumor inhibition from 58 ± 7% to 23 ± 9% (p<0.01), with partial restoration of mef2c/p38 and blunted autophagy marker elevation.
conclusions:
our findings indicate that mir-1248 enhances bortezomib sensitivity in mm cells by directly targeting mef2c, accompanied by reduced p38 expression and autophagic activity. The coordinated changes in mef2c and p38 define a functional axis that may be targeted to improve bortezomib response.
introduction
multiple myeloma (mm) remains incurable. The proteasome inhibitor bortezomib has improved patient outcomes, but many patients still respond poorly (–). Improving bortezomib sensitivity is therefore a key clinical goal.
autophagy, a conserved lysosomal degradation pathway, helps maintain cellular homeostasis by removing misfolded proteins and damaged organelles (). In mm cells, which often accumulate toxic immunoglobulin aggregates, autophagy can serve as a survival mechanism (). Bortezomib has been shown to modulate autophagy, with outcomes ranging from cytoprotection to cell death depending on context. In this study, we focus on bortezomib-induced autophagy that may enhance drug sensitivity rather than promote resistance.
micrornas regulate gene expression post-transcriptionally (). In mm, mirna expression profiles are frequently altered and linked to tumor progression, chemoresistance and autophagy (, ). To identify mirnas involved in bortezomib response, we performed rna-seq on bortezomib-treated rpmi8226 cells. Among the differentially expressed mirnas, mir-1248 showed the most significant upregulation (fold change >4, p<0.05). This mirna is located at 3q27.3. It has been reported to play opposing roles in different cancers: it promotes lung cancer but suppresses gastric cancer (–). However, its expression and function in mm, especially in bortezomib sensitivity and autophagy, remain unknown.
transcriptome analysis pointed to mef2c as a potential target of mir-1248. We also found that p38 mapk expression changed along with mef2c after modulating mir-1248. Both mef2c and p38 are known to play roles in stress responses and cell survival in other systems (–), but whether they are involved in autophagy regulation is not well established, especially in mm. We therefore asked if mir-1248 affects bortezomib sensitivity by coordinately regulating mef2c and p38, and whether this involves changes in autophagic activity.
in this study, we identify mir-1248 as a previously unrecognized regulator of bortezomib sensitivity in mm. We demonstrate that mir-1248 directly targets mef2c, and that this is accompanied by reduced p38 expression and suppression of autophagic activity. These findings define a coordinated mir-1248–mef2c–p38mapk axis that may serve as a potential therapeutic target to improve bortezomib response in mm.
materials and methods
genomic screening and target prediction
rpmi8226 cells (three biological replicates) were treated with 6 nm bortezomib for 24 h. Rna integrity was confirmed (rin >7.0). Stranded rna-seq libraries were prepared and sequenced on the dnbseq platform (paired-end, ~30 m reads/sample). Reads were aligned to hg38 with star v2.7, and gene counts obtained with featurecounts. Differential expression was analyzed with deseq2 (|fc|>4 or <0.25, p<0.05, fdr<0.05, benjamini-hochberg). Putative mir-1248 targets were predicted by mirdb and targetscan, then cross-referenced with rna-seq data. Mef2c was selected because it was predicted by both databases, its mrna decreased after bortezomib (while mir-1248 increased), and it is involved in stress signaling. Candidate expression was validated by qrt-pcr.
patients and sample collection
peripheral blood was collected from 30 newly diagnosed mm patients before and after one cycle of vcd chemotherapy (bortezomib, cyclophosphamide, dexamethasone). All participants gave informed consent; ethics approval no. Cyfyll2024049. Plasma was separated by centrifugation (300 × g, 15 min, 20 °c) and stored at ?80 °c. Rna was extracted using a mirna isolation kit (tiangen). Paired pre-/post-treatment samples were analyzed.
cell culture, transfection and infection
rpmi8226, u266 and 293t cells (atcc) were tested mycoplasma-negative (pcr) and used within 15 passages. Rpmi8226 and u266 were cultured in rpmi-1640, 293t in dmem, both with 10% fbs. For mir-1248 inhibition, cells were transfected with 50 nm inhibitor or nc (genepharma) using lipofectamine 3000, then treated with 6 nm bortezomib for 24 h. For luciferase assay, 293t cells were co-transfected with mir-1248 mimic or nc (50 nm) and wild-type/mutant mef2c 3?-Utr plasmids (gikegene) using lipofectamine 3000. For rescue, cells were infected with mef2c-overexpressing lentivirus (genepharma) at moi 90–110. All transfections were in triplicate.
rna extraction and qrt- pcr
total rna was extracted with trizol (invitrogen). Reverse transcription used tiangen kits. Qrt-pcr was run on an abi 7500. Mir-1248 was normalized to u6; mef2c, p38, beclin1, lamp1, lc3b to gapdh. Relative expression was calculated by 2-??Ct. Primers are listed in table 1. Three biological replicates, each with three technical repeats.
table 1
| factor | primer sequence | amplified fragment size(bp) |
|---|---|---|
| lc3 | f gccttcttcctgctggtgaacc r tcctcgtctttctcctgctcgtag | 86 |
| lamp1 | f ccacagtcggcaattcctacaag r ccagcagacactcctccacag | 144 |
| gapdh | f gcaccgtcaaggctgagaac r tggtgaagacgccagtgga | 138 |
| beclin1 | f cgccgtcttgaaccagctatcc r acttgtcccagattctgcacctttg | 121 |
| mef2c | f gagcgtgctgtgtgactgtgag r catgtcggtgctggcatactgg | 82 |
| p38 | f tggtgtgctctgcttatgataatgtc r agtaggtctggtgctcaaaggg | 81 |
sequences of primers used in qrt-pcr.
luciferase reporter assay
after 48 h co-transfection, cells were lysed with reporter lysis buffer (promega e397a). Firefly luciferase activity was measured and normalized to renilla using the dual-luciferase system (promega e1910).
western blot
cells or tumor tissues were lysed in ripa with phosphatase inhibitors (solarbio r0020). Protein (20 µg/lane) was separated on 12% sds-page, transferred to pvdf membranes (millipore ipvh00010), and blocked with 5% skim milk. Primary antibodies: anti-lc3 (abcam ab192890, 1:1000), anti-lamp1 (ab25630, 1:1000), anti-mef2c (ab78888, 1:1000), anti-p38 total (ab170099, 1:1000), anti-beclin1 (ab207612, 1:1000), and anti-gapdh (1:5000). Secondary: hrp-conjugated (abcam ab6721, 1:5000). Bands were visualized by ecl (gene flow) and quantified with imagej. Lc3-i and lc3-ii were separately quantified. Three independent experiments.
assessment of autophagic activity
acridine orange (beyotime c0233) and lyso-tracker red (mesgen mf8123) staining were performed per the manufacturers’ protocols. Stained cells were examined by fluorescence microscopy (excitation 488/515 nm for ao, 577/590 nm for lyso-tracker). These assays detect acidic vesicles and lysosomes, not autophagic flux.
cell viability
cck-8 assay (dojindo ck04) was used. After rescue, cells were seeded in 96-well plates (7×103 cells/well, five replicates). After 24 h bortezomib treatment, 10 µl cck-8 was added for 2 h at 37 °c. Absorbance at 450 nm was read. Viability was calculated relative to oe-nc untreated (100%). Three independent experiments.
xenograft model
male balb/c nude mice (5-6 weeks old, n=6/group) were injected subcutaneously with 5×106 rpmi8226 cells expressing mir-1248 inhibitor or nc (200 µl pbs, no matrigel). When tumors became palpable (~2 weeks), mice were randomly assigned to four groups: nacl+nc, bor+nc, nacl+mir-1248 inhibitor, bor+mir-1248 inhibitor. Bortezomib (0.5 mg/kg) or saline was injected intraperitoneally on days 1,4,8,11. Tumor volume was measured weekly with calipers and calculated as (length×width²)/2. Body weight was monitored twice weekly. Humane endpoint: tumor >2000 mm³, ulceration, or weight loss >20%. Mice were euthanized by co2 inhalation followed by cervical dislocation. The investigator measuring tumors was blinded to group. At day 35, tumors were excised and snap-frozen in liquid nitrogen.
statistical analysis
data are mean ± sd from ?3 biological replicates. Normality (shapiro-wilk) and equal variance (levene) were checked. Two-group comparisons used two-tailed t-test (unpaired for cells, paired for patient plasma). Multiple groups were compared by one-way anova with tukey’s post hoc test. Repeated tumor measurements were analyzed by mixed-effects model (geisser-greenhouse). P<0.05 was significant. Graphpad prism 9.0 was used.
result
rna sequencing identifies mir-1248 as a bortezomib-responsive mirna targeting the mef2c/mapk axis in mm
to identify mirnas responsive to bortezomib, we performed rna sequencing on rpmi8226 cells before and after treatment. Differentially expressed mirnas were identified using thresholds of |fold change| >4 and adjusted p < 0.05. Mir-1248 showed the most significant upregulation (fold change = 4.3, adjusted p = 0.008) and was selected based on fold change and statistical significance.
integrating targetscan, mirdb, and our mrna-seq data identified 123 common predicted target genes. Kegg pathway analysis showed enrichment in the mapk signaling pathway. Given the known role of mapk signaling in apoptosis and cellular response to bortezomib, we focused on this pathway. Among mapk-related genes, we prioritized mef2c because its mrna level decreased after bortezomib treatment, consistent with an inverse relationship to mir-1248 upregulation (figures 1a–c).
figure 1
validation experiments confirmed that bortezomib significantly increased mir-1248 and decreased mef2c mrna/protein in rpmi8226 and u266 cells (p<0.05, figures 1d–i). Clinically, plasma mir-1248 levels were elevated in 30 mm patients after one cycle of bortezomib-based therapy (vcd regimen) compared to baseline (p<0.05, figure 1j) (table 2). Correlation with treatment response was not performed due to limited sample size and follow-up.
table 2
| index | before | after |
|---|---|---|
| mir-1248(2-?Ct) | 1.00±0.0 | 2.06±0.71 |
| albumin(g/l) | 34.36±4.96 | 35.28±4.07 |
| serum creatinine(mmol/l) | 189.58±261.38 | 126.63±142.29 |
| ca2+(mmol/l) | 2.30±0.27 | 2.14±0.15 |
| ?2-mg(mg/l) | 9.43±8.15 | 5.78±5.07 |
| hb(g/l) | 90.15±21.72 | 96.85±22.13 |
| igg(g/l) | 18.88±20.57 | 12.81±12.66 |
| iga(g/l) | 10.66±22.07 | 5.82±12.39 |
| igm(g/l) | 0.32±0.26 | 0.31±0.21 |
| blood kappa(g/l) | 2061.8±4131.33 | 974±1195.17 |
| blood lambda(g/l) | 1271.07±1508.71 | 663.30±680.09 |
| urine kappa(mg/l) | 139.36±291.18 | 25.61±67.15 |
| urine lambda(mg/l) | 76.87±268.13 | 45.04±128.69 |
clinical parameters of 30 mm patients before and after bortezomib treatment(mean ± sd).
mir-1248 directly binds to mef2c 3?Utr and affects total p38 protein levels
targetscan predicted a putative mir-1248 binding site within the mef2c 3?Utr (figure 2a). We constructed luciferase reporters containing wild-type or mutant (four point mutations in the seed region) sequences. In 293t cells, mir-1248 mimics significantly reduced wild-type activity but did not affect the mutant (p < 0.05), supporting direct binding (figures 2b, c).
figure 2
transfection with mir-1248 inhibitor reversed bortezomib-induced mef2c suppression and restored total p38 levels (figures 2d–k). P38-mapk signaling is primarily regulated through phosphorylation; our data show changes in total p38 only and do not directly demonstrate pathway activity.
mir-1248 modulates bortezomib-induced changes in autophagy-associated markers and lysosomal compartments
mir-1248 inhibition partially attenuated bortezomib-induced upregulation of lc3b and beclin1 in both cell lines (figures 3a–f). Acridine orange staining showed that bortezomib increased acidic vesicles, an effect reduced by mir-1248 inhibition (figure 3g). Lysosomal content (lyso-tracker) and lamp1 expression showed similar patterns (p < 0.05, figures 3h–j). Together, these results indicate that mir-1248 modulates bortezomib-induced changes in autophagy-related protein expression and lysosomal compartments.
figure 3
mef2c overexpression attenuates bortezomib-induced apoptosis and reduces the upregulation of autophagy-associated markers
rpmi8226 and u266 cells were transduced with mef2c-overexpressing lentivirus (moi = 100 and 110, respectively; figure 4a). Stable clones showed significant upregulation of mef2c mrna and protein (p < 0.05, figures 4b–e). Mef2c overexpression significantly reduced bortezomib-induced apoptosis (cck-8 and flow cytometry) and blunted the changes in bax, cleaved caspase-3, and bcl-2 (p < 0.05, figures 4f–i).
figure 4
bortezomib-induced upregulation of lc3b, beclin1, and lamp1 was also suppressed by mef2c overexpression (figures 4j–q). Thus, mef2c overexpression protects against bortezomib-induced apoptosis and counteracts the bortezomib-induced increase in these autophagy-related markers.
inhibition of mir-1248 attenuates bortezomib-induced apoptosis and autophagy in multiple myeloma xenografts
rpmi8226 cells pre-transfected with mir-1248 inhibitor or nc were injected subcutaneously into nude mice (formation rate 93%). On day 14, 24 tumor-bearing mice were randomized into four groups (n=6, figures 5a, b). At the end of the experiment, mean tumor volume in the bor+nc group was 185 ± 42 mm³, while the bor+mir-1248 inhibitor group showed significantly larger tumors (412 ± 67 mm³, p < 0.01), with inhibition rates of 58% vs 21% (figures 5c–e).
figure 5
western blot showed that mir-1248 inhibition decreased bax and cleaved caspase-3 and increased bcl-2 under both nacl and bortezomib conditions (p < 0.05, figure 5f), indicating partial abrogation of bortezomib’s pro-apoptotic effect. Bortezomib-induced upregulation of lc3b, beclin1, and lamp1 was attenuated by mir-1248 inhibition, while bortezomib-suppressed mef2c and total p38 were partially restored (p < 0.05, figures 5g–l). These findings suggest that mir-1248 inhibition reduces bortezomib-induced changes in autophagy-related markers, possibly via restoring mef2c and total p38.
in conclusion, our data present a working model wherein mir-1248 binds to the 3?Utr of mef2c and negatively regulates total p38 levels, correlating with bortezomib-induced apoptosis and changes in autophagy-related markers in multiple myeloma cells. The observation that mir-1248 inhibition or mef2c overexpression alleviates bortezomib-induced cytotoxicity suggests that this axis contributes to cellular response to bortezomib. Modulating the mir-1248/mef2c/p38-mapk axis may represent a potential strategy to enhance bortezomib sensitivity in multiple myeloma.
discussion
in this study, we identified mir-1248 as a bortezomib-responsive mirna in multiple myeloma. Rna-seq and clinical sample validation showed that bortezomib treatment increased mir-1248 expression, accompanied by changes in mm cell proliferation and apoptosis. Mechanistically, mir-1248 directly targeted mef2c. This was associated with reduced total p38 levels and altered expression of autophagy-related markers (lc3b, beclin1, lamp1) — a function not previously reported in mm. Unlike its pro-tumor role in lung cancer, mir-1248 contributed to bortezomib sensitivity in mm, distinguishing it from other mirnas that modulate bortezomib response through different mechanisms. These findings were supported by in vivo xenograft experiments.
autophagy plays a dual role in myeloma cells: it supports survival under basal conditions but may lead to cell death when excessively activated (, –). Previous studies have shown that various therapeutic agents can shift this balance (–). Our results indicate that mir-1248-mediated downregulation of mef2c is linked to changes in autophagy-related markers upon bortezomib treatment. Inhibiting mir-1248 attenuated the bortezomib-induced increases in lc3b, beclin1, and lamp1, while partially restoring mef2c and total p38 expression. However, we measured only total p38, not phosphorylated p38; therefore, we cannot conclude whether the p38-mapk pathway is activated or inactivated. Likewise, our staining assays (acridine orange and lyso-tracker) detect acidic vesicular compartments and lysosomal changes, not autophagic flux. The directionality between mef2c and p38 in mm cells also remains unresolved — our data show that both change coordinately with mir-1248 modulation, but which acts upstream requires further investigation.
our experiments evaluated acute bortezomib response rather than acquired resistance. Thus, we interpret mir-1248 as a modulator of bortezomib sensitivity, not a mediator of resistance. We hypothesize that restoring mir-1248 expression might sensitize mm cells to bortezomib, but this needs direct testing using mir-1248 mimics in dose-response and long-term survival assays. Clinically, we observed that plasma mir-1248 levels increased after one cycle of vcd therapy (a bortezomib-containing regimen). This finding is preliminary. Whether baseline mir-1248 levels predict treatment response or outcome remains to be determined in larger, prospectively followed cohorts. Other limitations include the lack of rna pull-down to directly demonstrate the mir-1248-mef2c interaction, the absence of annexin v flow cytometry for apoptosis, and the use of immortalized cell lines without validation in primary mm cells. The xenograft study used a single model without a therapeutic intervention arm, and our experiments were performed only with bortezomib monotherapy, whereas current clinical regimens often combine bortezomib with other agents. The clinical sample size is modest (n=30) and single-center with no prognostic follow-up.
based on the above findings, we propose a schematic working model (figure 6) in which bortezomib-induced mir-1248 upregulation directly targets mef2c, accompanied by reduced total p38 expression and altered autophagy-related markers, collectively contributing to enhanced bortezomib sensitivity. Collectively, our results provide a biological rationale for further investigation of this mir-1248–mef2c–p38 axis as a potential strategy to improve bortezomib response in mm.
figure 6
statements
data availability statement
the original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.
ethics statement
the studies involving humans were approved by affiliated hospital of chengde medical college (approval no. Cyfyll2024049). The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent for participation in this study was provided by the participants’ legal guardians/next of kin. The animal study was approved by affiliated hospital of chengde medical college (approval no. Cyfyll2024049). The study was conducted in accordance with the local legislation and institutional requirements.
author contributions
ww: writing – original draft, conceptualization, writing – review & editing, investigation. R-jz: writing – review & editing, methodology, data curation. M-sm: software, data curation, formal analysis, writing – review & editing. X-ms: data curation, conceptualization, investigation, writing – review & editing. Qz: validation, formal analysis, data curation, writing – review & editing. Cl: formal analysis, validation, writing – review & editing. Z-hz: supervision, funding acquisition, writing – review & editing. C-lh: supervision, writing – review & editing, funding acquisition.
funding
the author(s) declared that financial support was received for this work and/or its publication. This work was supported by the natural science foundation of hebei province (grant no. H2022406041).
conflict of interest
the author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
generative ai statement
the author(s) declared that generative ai was not used in the creation of this manuscript.
any alternative text (alt text) provided alongside figures in this article has been generated by frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
publisher’s note
all claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
abbreviations
ac, absorbance of control; anova, analysis of variance; as, absorbance of sample; ab, absorbance of blank; bax, bcl2-associated x protein; bca, bicinchoninic acid assay; bcl-2, b-cell lymphoma 2; bor, bortezomib; cck-8, cell counting kit-8; cdna, complementary dna; dmem, dulbecco’s modified eagle medium; dnbseq, dna nanoball sequencing; ecl, enhanced chemiluminescence; fbs, fetal bovine serum; gapdh, glyceraldehyde-3-phosphate dehydrogenase; hrp, horseradish peroxidase; kegg, kyoto encyclopedia of genes and genomes; lamp1, lysosomal-associated membrane protein 1; lc3b, microtubule-associated protein 1 light chain 3 beta; mapk, mitogen-activated protein kinase; mef2c, myocyte enhancer factor 2c; mirna (or mir), microrna; mm, multiple myeloma; moi, multiplicity of infection; nc, negative control; oe, overexpression; p38, p38 mitogen-activated protein kinase; pbs, phosphate-buffered saline; pcr, polymerase chain reaction; pvdf, polyvinylidene fluoride; qrt-pcr, quantitative real-time polymerase chain reaction; ripa, radioimmunoprecipitation assay buffer; rpmi, roswell park memorial institute (medium); sds-page, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; u6, small nuclear rna u6; 3?Utr, three prime untranslated region
references
1
kodamaysaburimkawanokuraisamiktakatahmiyazakiyet al. Multiple myeloma with myelofibrosis at diagnosis and aggressive extramedullary relapse after autologous stem cell transplantation. Rinsho ketsueki. (2024) 65:1–6. Doi: 10.11406/rinketsu.65.1
2
di lerniagleonepsolimandoagbuonavogliaasaltarellairiaret al. Bortezomib treatment modulates autophagy in multiple myeloma. J clin med. (2020) 9:552. Doi: 10.3390/jcm9020552
3
jungshparksslimjysohnsykimnykimdet al. Single-cell analysis of multiple myelomas refines the molecular features of bortezomib treatment responsiveness. Exp mol med. (2022) 54:1967–78. Doi: 10.1038/s12276-022-00884-z
4
desantisvsaltarellailamanuzziamariggiòmaracanellivvaccaaet al. Autophagy: a new mechanism of prosurvival and drug resistance in multiple myeloma. Transl oncol. (2018) 11:1350–7. Doi: 10.1016/j.Tranon.2018.08.014
5
escalanteammcgrathrtkarolakmrdorrrtlynchrmlandowskith. Preventing the autophagic survival response by inhibition of calpain enhances the cytotoxic activity of bortezomib in vitro and in vivo. Cancer chemother pharmacol. (2013) 71:1567–76. Doi: 10.1007/s00280-013-2156-3
6
kozalakgbütün?Toyraneko?Ara. Review on bortezomib resistance in multiple myeloma and potential role of emerging technologies. Pharm (basel). (2023) 16:111. Doi: 10.3390/ph16010111
7
abduhms. An overview of multiple myeloma: a monoclonal plasma cell malignancys diagnosis, management, and treatment modalities. Saudi j biol sci. (2024) 31:103920. Doi: 10.1016/j.Sjbs.2023.103920
8
wilsonrblathigaradkaushald. Systematic review and meta-analysis of the impact of bariatric surgery on future cancer risk. Int j mol sci. (2023) 24:6192. Doi: 10.3390/ijms24076192
9
tangxrenhguomqianjyangyguc. Review on circular rnas and new insights into their roles in cancer. Comput struct biotechnol j. (2021) 19:910–28. Doi: 10.1016/j.Csbj.2021.01.018
10
szudy-szczyrekaahernskrawczykjszczyrekmhusm. Mirna as a potential target for multiple myeloma therapy-current knowledge and perspectives. J pers med. (2022) 12:1428. Doi: 10.3390/jpm12091428
11
chendyangxliumzhangzxinge. Roles of mirna dysregulation in the pathogenesis of multiple myeloma. Cancer gene ther. (2021) 28:1256–68. Doi: 10.1038/s41417-020-00291-4
12
baizshenj. Effect of autologous stem cell transplantation combined with modified vtd regimen on elderly patients with multiple myeloma and its influence on mirna cytokines. Comput math methods med. (2022) 2022:6320329. Doi: 10.1155/2022/6320329
13
tutary. Mirna and cancer; computational and experimental approaches. Curr pharm bio/technol. (2014) 15:429. Doi: 10.2174/138920101505140828161335
14
chenxliazhanqjingzchenychenj. Microrna-637 promotes apoptosis and suppresses proliferation and autophagy in multiple myeloma cell lines via nupr1. Febs open bio. (2021) 11:519–28. Doi: 10.1002/2211-5463.13063
15
amodionstamatomagullàammorellieromeoeraimondilet al. Therapeutic targeting of mir-29b/hdac4 epigenetic loop in multiple myeloma. Mol cancer ther. (2016) 15:1364–75. Doi: 10.1158/1535-7163.Mct-15-0985
16
yueqxuydengxwangsqiujqianbet al. Circ-pitx1 promotes the progression of non-small cell lung cancer through regulating the mir-1248/ccnd2 axis. Onco targets ther. (2021) 14:1807–19. Doi: 10.2147/ott.S286820
17
zhangywangmzangxmaozchenymaofet al. Circhn1 affects cell proliferation and migration in gastric cancer. J clin lab anal. (2020) 34:e23433. Doi: 10.1002/jcla.23433
18
panganibanrppinkertonmhmarusyjeffersonsjroffanishmaelft. Differential microrna expression in asthma and the role of mir-1248 in regulation of il-5. Am j clin exp immunol. (2012) 1:154–65.
19
duxliuhliuxchenxyuanlmayet al. Microcystin-lr induces ovarian injury and apoptosis in mice via activating apoptosis signal-regulating kinase 1-mediated p38/jnk pathway. Ecotoxicol environ saf. (2021) 213:112066. Doi: 10.1016/j.Ecoenv.2021.112066
20
novakovaktörökmpanajatovicmbouitbirjduongfhthandschincet al. Pgc-1? And mef2 regulate the transcription of the carnitine transporter octn2 gene in c2c12 cells and in mouse skeletal muscle. Int j mol sci. (2022) 23:12304. Doi: 10.3390/ijms232012304
21
chenlflyonsmrliufgreenmvhedrickngwilliamsabet al. The nmda receptor subunit glun3a regulates synaptic activity-induced and myocyte enhancer factor 2c (mef2c)-dependent transcription. J biol chem. (2020) 295:8613–27. Doi: 10.1074/jbc.Ra119.010266
22
kimjaydemirtbjimenez-rondanfrruggierochkimmhcousinsrj. Deletion of metal transporter zip14 (slc39a14) produces skeletal muscle wasting, endotoxemia, mef2c activation and induction of mir-675 and hspb7. Sci rep. (2020) 10:4050. Doi: 10.1038/s41598-020-61059-2
23
bektikesunydennisatsakonpyangddeschênesiet al. Inhibition of creb-cbp signaling improves fibroblast plasticity for direct cardiac reprogramming. Cells. (2021) 10:1572. Doi: 10.3390/cells10071572
24
qaisarrpharaohgbhaskaransxuhranjitrbianjet al. Restoration of sarcoplasmic reticulum ca2+ atpase (serca) activity prevents age-related muscle atrophy and weakness in mice. Int j mol sci. (2020) 22:37. Doi: 10.3390/ijms22010037
25
schulzlyoungaeliufgattinenisghoshssdouglasseet al. Atypical p38 kinase signaling in retinal vascular damage and recovery. Faseb j. (2025) 39:e71334. Doi: 10.1096/fj.202503114r
26
kozalakgko?Ara. Autophagy-related mechanisms for treatment of multiple myeloma. Cancer drug resist. (2023) 6:838–57. Doi: 10.20517/cdr.2023.108
27
bashirihtabatabaeianh. Autophagy: a potential therapeutic target to tackle drug resistance in multiple myeloma. Int j mol sci. (2023) 24:6019. Doi: 10.3390/ijms24076019
28
morellieleoneecantafiomedi martinomtamodionbiamontelet al. Selective targeting of irf4 by synthetic microrna-125b-5p mimics induces anti-multiple myeloma activity in vitro and in vivo. Leukemia. (2015) 29:2173–83. Doi: 10.1038/leu.2015.124
29
aasskrnedaltmvtryggestadsshaukåseslørdahltswaageaet al. Paired mirna- and messenger rna-sequencing identifies novel mirna-mrna interactions in multiple myeloma. Sci rep. (2022) 12:12147. Doi: 10.1038/s41598-022-16448-0
30
zhanglrastgoonwujzhangmpourabdollahmzacksenhauseet al. Marcks inhibition cooperates with autophagy antagonists to potentiate the effect of standard therapy against drug-resistant multiple myeloma. Cancer lett. (2020) 480:29–38. Doi: 10.1016/j.Canlet.2020.03.020
31
xueljiatzhuyzhaolmaoj. Down-regulation of circ_0058058 suppresses proliferation, angiogenesis and metastasis in multiple myeloma through mir-338-3p/atg14 pathway. J orthop surg res. (2021) 16:723. Doi: 10.1186/s13018-021-02867-8
32
kocaturknmakkocykigcbayraktarogozuacikdkutluo. Autophagy as a molecular target for cancer treatment. Eur j pharm sci. (2019) 134:116–37. Doi: 10.1016/j.Ejps.2019.04.011
33
yunzzhichaojhaoyoujranywendet al. Targeting autophagy in multiple myeloma. Leuk res. (2017) 59:97–104. Doi: 10.1016/j.Leukres.2017.06.002
34
al-odatosguirguisdaschmalbachnkyaogbudak-alpdogantjonnalagaddascet al. Autophagy and apoptosis: current challenges of treatment and drug resistance in multiple myeloma. Int j mol sci. (2022) 24:644. Doi: 10.3390/ijms24010644
35
handahmurakamiyishihararkimura-masudakmasuday. The role and function of microrna in the pathogenesis of multiple myeloma. Cancers (basel). (2019) 11:1738. Doi: 10.3390/cancers11111738
36
amodiondi martinomtneriatagliaferriptassonep. Non-coding rna: a novel opportunity for the personalized treatment of multiple myeloma. Expert opin biol ther. (2013) 13 suppl 1:s125–37. Doi: 10.1517/14712598.2013.796356
37
coiraifrincónrcuendetm. The multiple myeloma landscape: epigenetics and non-coding rnas. Cancers (basel). (2022) 14:2348. Doi: 10.3390/cancers14102348
38
zhaoywangzzhangwzhangl. Non-coding rnas regulate autophagy process via influencing the expression of associated protein. Prog biophys mol biol. (2020) 151:32–9. Doi: 10.1016/j.Pbiomolbio.2019.11.009
39
?Uczkowskakrogi?Skadula?Czykzpaczkowskaeschmidtcamachali?Skib. Molecular mechanisms of bortezomib action: novel evidence for the mirna-mrna interaction involvement. Int j mol sci. (2020) 21:350. Doi: 10.3390/ijms21010350
40
linqshiyliuzmehrpourmhamaïagongc. Non-coding rnas as new autophagy regulators in cancer progression. Biochim biophys acta mol basis dis. (2022) 1868:166293. Doi: 10.1016/j.Bbadis.2021.166293
41
lisxubluoyluojhuangsguox. Autophagy and apoptosis in rabies virus replication. Cells. (2024) 13:183. Doi: 10.3390/cells13020183
42
zhaosguoyyinx. Autophagy, ferroptosis, apoptosis and pyroptosis in metabolic dysfunction-associated steatotic liver disease. Front biosci (landmark ed). (2024) 29:30. Doi: 10.31083/j.Fbl2901030
43
wangmchenxliswangltanghpuyet al. A crosstalk between autophagy and apoptosis in intracerebral hemorrhage. Front cell neurosci. (2024) 18:1445919. Doi: 10.3389/fncel.2024.1445919
44
biswasuroyrghoshschakrabartig. The interplay between autophagy and apoptosis: its implication in lung cancer and therapeutics. Cancer lett. (2024) 585:216662. Doi: 10.1016/j.Canlet.2024.216662
45
ahsannshariqmsuroliaarajrkhanmfkumarp. Multipronged regulation of autophagy and apoptosis: emerging role of trim proteins. Cell mol biol lett. (2024) 29:13. Doi: 10.1186/s11658-023-00528-8
46
daidchenclucguoyliqsunc. Apoptosis, autophagy, ferroptosis, and pyroptosis in cisplatin-induced ototoxicity and protective agents. Front pharmacol. (2024) 15:1430469. Doi: 10.3389/fphar.2024.1430469
47
kobayashihimanakasyoshimotocmatsubarasshigetomih. Molecular mechanism of autophagy and apoptosis in endometriosis: current understanding and future research directions. Reprod med biol. (2024) 23:e12577. Doi: 10.1002/rmb2.12577
48
linzlongfkangrklionskydjyangmtangd. The lipid basis of cell death and autophagy. Autophagy. (2024) 20:469–88. Doi: 10.1080/15548627.2023.2259732
49
luyzhoujwanghgaohningeshaozet al. Endoplasmic reticulum stress-mediated apoptosis and autophagy in osteoarthritis: from molecular mechanisms to therapeutic applications. Cell stress chaperones. (2024) 29:805–30. Doi: 10.1016/j.Cstres.2024.11.005
50
liuhyaoqwangxxiehyangcgaohet al. The research progress of crosstalk mechanism of autophagy and apoptosis in diabetic vascular endothelial injury. Biomed pharmacother. (2024) 170:116072. Doi: 10.1016/j.Biopha.2023.116072
51
liaohliusmaqhuanghgoelatorabianpet al. Endoplasmic reticulum stress induced autophagy in cancer and its potential interactions with apoptosis and ferroptosis. Biochim biophys acta mol cell res. (2025) 1872:119869. Doi: 10.1016/j.Bbamcr.2024.119869
52
chakrabortysnandipmishrajniharikaroyamannaset al. Molecular mechanisms in regulation of autophagy and apoptosis in view of epigenetic regulation of genes and involvement of liquid-liquid phase separation. Cancer lett. (2024) 587:216779. Doi: 10.1016/j.Canlet.2024.216779
53
kapuyo. Mechanism of decision making between autophagy and apoptosis induction upon endoplasmic reticulum stress. Int j mol sci. (2024) 25:4368. Doi: 10.3390/ijms25084368
54
menonnakumarcdramachandranpblaizebgautammcordanimet al. Small-molecule inhibitors of wnt signalling in cancer therapy and their links to autophagy and apoptosis. Eur j pharmacol. (2025) 986:177137. Doi: 10.1016/j.Ejphar.2024.177137
55
ahmedkrrahmanmmislammnfahimmmhrahmanmakimb. Antioxidants activities of phytochemicals perspective modulation of autophagy and apoptosis to treating cancer. Biomed pharmacother. (2024) 174:116497. Doi: 10.1016/j.Biopha.2024.116497
56
zhangdsongjzhanjwangydengjdengy. The impact of ulinastatin on lymphocyte apoptosis and autophagy in sepsis patients. Sci rep. (2024) 14:28791. Doi: 10.1038/s41598-024-79878-y
57
singhrgaursknagarrkaulr. Insights into the different mechanisms of autophagy and apoptosis mediated by morbilliviruses. Virology. (2025) 603:110371. Doi: 10.1016/j.Virol.2024.110371
58
liyyqinzhshengr. The multiple roles of autophagy in neural function and diseases. Neurosci bull. (2024) 40:363–82. Doi: 10.1007/s12264-023-01120-y
59
ibathelmsjmaierclferrerrlevyjh. Autophagy and autophagic cell death in sepsis: friend or foe? J intensive care. (2024) 12:41. Doi: 10.1186/s40560-024-00754-y
60
zhaohfuxzhangychencwangh. The role of pyroptosis and autophagy in the nervous system. Mol neurobiol. (2024) 61:1271–81. Doi: 10.1007/s12035-023-03614-2
summary
keywords
apoptosis, autophagy, bortezomib, mapk pathway, mef2c, mir-1248, multiple myeloma
citation
wang w, zhang r, ma m, shi x, zhang q, li c, zhang z and hao c (2026) mir-1248 enhances bortezomib-induced autophagy by targeting mef2c/p38-mapk signaling in multiple myeloma. Front. Oncol. 16:1847922. Doi: 10.3389/fonc.2026.1847922
received
05 april 2026
revised
24 may 2026
accepted
27 may 2026
published
26 june 2026
volume
16 - 2026
edited by
christos k. Kontos, national and kapodistrian university of athens, greece
reviewed by
sina habibi, iran university of medical sciences, iran
pawe? Tyrna, medical centre for postgraduate education, poland
updates
copyright
© 2026 wang, zhang, ma, shi, zhang, li, zhang and hao.
this is an open-access article distributed under the terms of the creative commons attribution license (cc by). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*correspondence: zhi-hua zhang, zzhangzhihua@163.Com; chang-lai hao, haochanglaicyfy@163.Com
disclaimer
all claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher. |
| ( Read More... | 74480 bytes more | comments? | ) |
| |
| KOMMONSENTSJANE - Why the Stock Market REFUSES to Crash | WARREN BUFFETT |
| Posted on Friday, June 26 @ 00:02:41 PDT (8 reads) | |
|
|
Kommonsentsjane
this wordpress.Com site is the bees knees
?
kommonsentsjane – if only – the left could come to grips and join the rest of the country for freedom and the american way?
kommonsentsjane – why the stock market refuses to crash | warren buffett
posted on
june 26, 2026
by
kommonsentsjane
06/25/2026
for your information:
ttps://www.Youtube.Com/watch?V=7lziuyercba
kommonsentsjane
about kommonsentsjane
enjoys sports and all kinds of music, especially dance music. Playing the keyboard and piano are favorites. Family and friends are very important.
view all posts by kommonsentsjane
?
this entry was posted in
uncategorized
. Bookmark the
permalink
.
?
kommonsentsjane – if only – the left could come to grips and join the rest of the country for freedom and the american way?
leave a comment
cancel reply
?
search for:
archives
june 2026
may 2026
april 2026
march 2026
february 2026
january 2026
december 2025
november 2025
october 2025
september 2025
august 2025
july 2025
june 2025
may 2025
april 2025
march 2025
february 2025
january 2025
december 2024
november 2024
october 2024
september 2024
august 2024
july 2024
june 2024
may 2024
april 2024
march 2024
february 2024
january 2024
december 2023
november 2023
october 2023
september 2023
august 2023
july 2023
june 2023
may 2023
april 2023
march 2023
february 2023
january 2023
december 2022
november 2022
october 2022
september 2022
august 2022
july 2022
june 2022
may 2022
april 2022
march 2022
february 2022
january 2022
december 2021
november 2021
october 2021
september 2021
august 2021
july 2021
june 2021
may 2021
april 2021
march 2021
february 2021
january 2021
december 2020
november 2020
october 2020
september 2020
august 2020
july 2020
june 2020
may 2020
april 2020
march 2020
february 2020
january 2020
december 2019
november 2019
october 2019
september 2019
august 2019
july 2019
june 2019
may 2019
april 2019
march 2019
february 2019
january 2019
december 2018
november 2018
october 2018
september 2018
august 2018
july 2018
june 2018
may 2018
april 2018
march 2018
february 2018
january 2018
december 2017
november 2017
october 2017
september 2017
august 2017
july 2017
june 2017
may 2017
april 2017
march 2017
february 2017
january 2017
december 2016
november 2016
october 2016
september 2016
august 2016
july 2016
june 2016
may 2016
april 2016
march 2016
february 2016
january 2016
december 2015
november 2015
october 2015
september 2015
august 2015
july 2015
june 2015
may 2015
april 2015
march 2015
february 2015
january 2015
december 2014
november 2014
october 2014
september 2014
august 2014
july 2014
june 2014
may 2014
april 2014
march 2014
february 2014
january 2014
december 2013
november 2013
october 2013
september 2013
august 2013
july 2013
june 2013
may 2013
april 2013
march 2013
february 2013
january 2013
december 2012
november 2012
october 2012
september 2012
august 2012
kommonsentsjane
june 2026
may 2026
april 2026
march 2026
february 2026
january 2026
december 2025
november 2025
october 2025
september 2025
august 2025
july 2025
june 2025
may 2025
april 2025
march 2025
february 2025
january 2025
december 2024
november 2024
october 2024
september 2024
august 2024
july 2024
june 2024
may 2024
april 2024
march 2024
february 2024
january 2024
december 2023
november 2023
october 2023
september 2023
august 2023
july 2023
june 2023
may 2023
april 2023
march 2023
february 2023
january 2023
december 2022
november 2022
october 2022
september 2022
august 2022
july 2022
june 2022
may 2022
april 2022
march 2022
february 2022
january 2022
december 2021
november 2021
october 2021
september 2021
august 2021
july 2021
june 2021
may 2021
april 2021
march 2021
february 2021
january 2021
december 2020
november 2020
october 2020
september 2020
august 2020
july 2020
june 2020
may 2020
april 2020
march 2020
february 2020
january 2020
december 2019
november 2019
october 2019
september 2019
august 2019
july 2019
june 2019
may 2019
april 2019
march 2019
february 2019
january 2019
december 2018
november 2018
october 2018
september 2018
august 2018
july 2018
june 2018
may 2018
april 2018
march 2018
february 2018
january 2018
december 2017
november 2017
october 2017
september 2017
august 2017
july 2017
june 2017
may 2017
april 2017
march 2017
february 2017
january 2017
december 2016
november 2016
october 2016
september 2016
august 2016
july 2016
june 2016
may 2016
april 2016
march 2016
february 2016
january 2016
december 2015
november 2015
october 2015
september 2015
august 2015
july 2015
june 2015
may 2015
april 2015
march 2015
february 2015
january 2015
december 2014
november 2014
october 2014
september 2014
august 2014
july 2014
june 2014
may 2014
april 2014
march 2014
february 2014
january 2014
december 2013
november 2013
october 2013
september 2013
august 2013
july 2013
june 2013
may 2013
april 2013
march 2013
february 2013
january 2013
december 2012
november 2012
october 2012
september 2012
august 2012
categories
– flash mob dancng
– garner state park
2016
2024 – abortion
9/11 museum
a giant panda rolling in the snow
abortion.
abortions
adhd
afghanistan
again
airplane travel.
alcohol vs drugs
amazing grace and light show
america
americas currency
americas wake up call
american indians
amnesty tricks
article v of constitution
baggy pants vs sizzle
battle 1946
benghazi
bergdahl cover up
bidens vows
boehner and the impeaching
boston bombing.
bread story
break the immigration impasse critique
bureau of land management
bureau of land managment
canada
candy recipe
capitalism or hammer/sickle
cars
charity and business
children
christians vs non believers.
cigarettes versus marijuana
cinco de mayo real story
civil rights
class reunions
clinton and obama
colleges
constitution
constitution of u.S.
corruption in the halls of government
courts
criminal immigrants
democrat diversions
democratic party
democratic senate
democrats
democrats vs republicans
discrimination
drugs.
easter
education
election pecking order change
elections
elite republicans
entertainment
environment
environmental protection agency (epa)
european union (eu)
ex-nanny mayor of new york
executive orders.
family
fandangle
financial
food
food labels
football
foreign countries
fraud and corruption
friday/holiday news dump
fun stories
global warming
government
government and culture
government debt.
government shutdown
guns
haitis blight
harvard and privilege
harvards satanic ritual
helping hands.
hillary
hillary clinton
hillarys exploitation
hillarys re-launch
holders whining
holiday greetings
hollywood
holy cow
homes & families.
how do you litter?
human rights violation in saudi arabia
hygiene
immigration
internet
iraq and isis
irs
isis vs isil
islam
islam and the world
islam vs christianity
islamophobia
israel
israel and palestine
it is called discipline.
jobs not birth control pills
keystone pipeline
kkommonsentsjane – the messiah
kmmonsentsjane – merry christmas pledge
kommmonsentsjane – a new tool in voting – uh?
kommnonsentsjane – glen beck
kommnonsentsjane – trump is right – the west has sold their soul
kommnsentsjane – australia
kommnsentsjane – kasich is an elite republican
kommnsentsjane – one world order
kommnsentsjane – the real con artist
kommnsentsjane – washington rally
kommoncentsjane – breaking the constitution
kommonentsjane – netanyahu
kommonentsjane – people dont care how corrupt the government is
kommonentsjane – political corruption
kommonentsjane – stop common core
kommonentsjane – the voting pill
kommonsensjane – cruz insults americans calling the anti-science zealots
kommonsensjane – immigration and h-lb visas
kommonsensjane – obama and netanyahu
kommonsensjane – obama and the duck story
kommonsensjane – obama lieing again
kommonsensjane – sharia law
kommonsensjane – who is apple protecting
kommonsentjane – a letter to obama
kommonsentjane – education – no child left behind
kommonsentjane – food for thought – all of a sudden
kommonsentjane – found 3 boeing planes
kommonsentjane – germanys muslim population
kommonsentjane – hillary benghazi and box cars
kommonsentjane – is this what you call the new world order?
kommonsentjane – joe biden
kommonsentjane – labor day
kommonsentjane – obama at the wrong mosque
kommonsentjane – presidential lies
kommonsentjane – senator barbara boxer
kommonsentjane – the muslim brotherhood review
kommonsentjane – the people have spoken
kommonsentjane – troops and dogs betrayed
kommonsentjane – trump
kommonsentjane – two political parties are behind the eight ball
kommonsentjsnae – obama defiant and defensive
kommonsents – the job numbers
kommonsents – the real king is oil
kommonsentsane – hillary and fbi
kommonsentsentsjane – over reach
kommonsentsentsjane – the kurds
kommonsentsentsjane – top ten secret societies
kommonsentsjae – obama poster
kommonsentsjane – a bunch of bed-wetters: trump 2024 campaign manager blows off us economy mayhem.
kommonsentsjane – 13 bald eagles poisoned
kommonsentsjane – 1919 rules of communism
kommonsentsjane – 1997 again
kommonsentsjane – 2/5/2015 prayer breakfast
kommonsentsjane – 20 things that make you more productive
kommonsentsjane – 2014 annual review
kommonsentsjane – 2014 election results
kommonsentsjane – 2014 tax money
kommonsentsjane – 2015 budget
kommonsentsjane – 2016
kommonsentsjane – 2016 ballot
kommonsentsjane – 2016 bucket list
kommonsentsjane – 2016 election
kommonsentsjane – 2016 iowa recount results.
kommonsentsjane – 2016 pesidential race
kommonsentsjane – 2016 presidential race
kommonsentsjane – 2017 war
kommonsentsjane – 23% of iowa people are socialists
kommonsentsjane – 25 things about life i wish i had known 10 years ago
kommonsentsjane – 37% approves while getting the shaft
kommonsentsjane – 9/11
kommonsentsjane – 9/11 celebration proof
kommonsentsjane – 9/11 exposing the killers families
kommonsentsjane – a 9/11 pilots story
kommonsentsjane – a bad look at war
kommonsentsjane – a barber story
kommonsentsjane – a baseball experience
kommonsentsjane – a birthday prayer for president trump.
kommonsentsjane – a birthday wish
kommonsentsjane – a brokered convention
kommonsentsjane – a car-jacking
kommonsentsjane – a child and a dog
kommonsentsjane – a christian nation
kommonsentsjane – a christian speaking
kommonsentsjane – a compromised bill killed by obama
kommonsentsjane – a conservative professor
kommonsentsjane – a conservatives take on the recent protests of un of mo
kommonsentsjane – a different view of trump
kommonsentsjane – a dogs will
kommonsentsjane – a dog;s tale
kommonsentsjane – a fight for americas freedom
kommonsentsjane – a florida professor
kommonsentsjane – a frustration message
kommonsentsjane – a future preacher
kommonsentsjane – a good question for america
kommonsentsjane – a humbling experience
kommonsentsjane – a lady who knows politics
kommonsentsjane – a lawyers findings
kommonsentsjane – a letter from god
kommonsentsjane – a liberal journalist
kommonsentsjane – a marine story
kommonsentsjane – a message for the west from the exiled archbishop of mosul
kommonsentsjane – a mothers fear
kommonsentsjane – a new christmas song
kommonsentsjane – a new day
kommonsentsjane – a new fiction horror story
kommonsentsjane – a new health care plan
kommonsentsjane – a new holiday called government assistance day
kommonsentsjane – a new type of car
kommonsentsjane – a new type of shame recognition
kommonsentsjane – a new voice for tomorrow
kommonsentsjane – a new way of voting
kommonsentsjane – a pandas roll in the snow
kommonsentsjane – a pep talk to america
kommonsentsjane – a phone scam
kommonsentsjane – a political play on words
kommonsentsjane – a pot of grease
kommonsentsjane – a prayer for america
kommonsentsjane – a rant
kommonsentsjane – a real debate
kommonsentsjane – a rich mans inspiration
kommonsentsjane – a secret revealed – from the border to virginia
kommonsentsjane – a special app for hackers
kommonsentsjane – a tree church
kommonsentsjane – a trump parody
kommonsentsjane – a wedge issue
kommonsentsjane – a wet noodle
kommonsentsjane – a woman story
kommonsentsjane – a word to the wise should be sufficient.
kommonsentsjane – abbas
kommonsentsjane – abbas joins terrorist hamas
kommonsentsjane – abortion dollars going to planned parenthood
kommonsentsjane – abortions
kommonsentsjane – ace your base
kommonsentsjane – acrobats
kommonsentsjane – admiral james a lyons
kommonsentsjane – advice from an israeli agent – fyi
kommonsentsjane – afghan cadets missing from base
kommonsentsjane – afghan children
kommonsentsjane – ag and the truth
kommonsentsjane – ag loretta lynch trying to help illegals vote
kommonsentsjane – age
kommonsentsjane – aging
kommonsentsjane – airline pilot speaks his mind
kommonsentsjane – al gore and his scientific fantasies
kommonsentsjane – alex griswold
kommonsentsjane – all about the 50s
kommonsentsjane – all lives matter
kommonsentsjane – all lives matters
kommonsentsjane – all part of the plan
kommonsentsjane – alll of a sudden
kommonsentsjane – america
kommonsentsjane – america and kerry
kommonsentsjane – america and obamas decay
kommonsentsjane – america and the socialist
kommonsentsjane – america at risk
kommonsentsjane – america in peril
kommonsentsjane – america in trouble
kommonsentsjane – america is being shut down
kommonsentsjane – america s tribes
kommonsentsjane – americas affluence
kommonsentsjane – americas awakening
kommonsentsjane – americas birthday
kommonsentsjane – americas bread winners
kommonsentsjane – americas clean-up
kommonsentsjane – americas economy
kommonsentsjane – americas exceptionalism
kommonsentsjane – americas freedoms
kommonsentsjane – americas friend
kommonsentsjane – americas government
kommonsentsjane – americas landmark
kommonsentsjane – americas military
kommonsentsjane – americas political system
kommonsentsjane – americas severe weather
kommonsentsjane – americas terrorist war
kommonsentsjane – american civil liberties
kommonsentsjane – american flag
kommonsentsjane – american flag at white house
kommonsentsjane – american people get the shaft
kommonsentsjane – american schools
kommonsentsjane – american teacher stabbed in rest room in abu dhabi
kommonsentsjane – american terrorist killed
kommonsentsjane – american values
kommonsentsjane – americans are being betrayed
kommonsentsjane – americans live under the constitution – end of story
kommonsentsjane – an angels advice
kommonsentsjane – an english writer
kommonsentsjane – an excuse for looting
kommonsentsjane – an inhuman war
kommonsentsjane – analyzing yourself and pills
kommonsentsjane – anchor babies
kommonsentsjane – anchor or jack-pot babies
kommonsentsjane – andy rooney and pray if you want
kommonsentsjane – angry white socialist democrat
kommonsentsjane – ann coulter demolishes weak gop that surrender when called racist! The new conservative movement
kommonsentsjane – ann coulter, trump, obama
kommonsentsjane – another $1 billion recovered in ‘misplaced funds’: doge
kommonsentsjane – another atheist group after the nativity
kommonsentsjane – another attempt to kill by isis
kommonsentsjane – another big lie
kommonsentsjane – another company going to mexico
kommonsentsjane – another countrywide home loan scam coming
kommonsentsjane – another democrat gun crisis
kommonsentsjane – another epa violation
kommonsentsjane – another jack nicholson play on words
kommonsentsjane – another katrina by the mayor
kommonsentsjane – another lack of common sense
kommonsentsjane – another liberal media blow up
kommonsentsjane – another obama trick
kommonsentsjane – another pretend to be american
kommonsentsjane – another soldier let go
kommonsentsjane – another sununu rant
kommonsentsjane – another terrorist killing episode
kommonsentsjane – anti-christians
kommonsentsjane – anti-islam protests
kommonsentsjane – apollo 11 celebration on the qt
kommonsentsjane – appeals court rules – citizens retain right to bear arms
kommonsentsjane – approval numbers and red meat
kommonsentsjane – april 15 tax day
kommonsentsjane – arab hatred
kommonsentsjane – arab-israeli conflict
kommonsentsjane – are all politicians liars
kommonsentsjane – are americans going to stand for downward trend
kommonsentsjane – are universities unsafe
kommonsentsjane – are we going to allow america to shift to socialism
kommonsentsjane – are you a fool
kommonsentsjane – are you a thinker or a follower
kommonsentsjane – are you quick on the draw of decisions
kommonsentsjane – area 51
kommonsentsjane – ariana grande
kommonsentsjane – arizona votes to stop obama
kommonsentsjane – arlin report – thought of the day
kommonsentsjane – arlins thought of the day
kommonsentsjane – arlington cemetery – who is in charge
kommonsentsjane – army
kommonsentsjane – army betrays troops – destroy heroic dogs
kommonsentsjane – army rangers
kommonsentsjane – arquettes oscar statement
kommonsentsjane – atheists
kommonsentsjane – atheists and love of any god
kommonsentsjane – atheists fighting the bible again
kommonsentsjane – atheists in america
kommonsentsjane – audit the gold
kommonsentsjane – aurora theater deaths
kommonsentsjane – avast
kommonsentsjane – awkward santa joke
kommonsentsjane – axelrod polls
kommonsentsjane – axelrod, nbc, is manipulating the numbers
kommonsentsjane – b. Watsons thoughts
kommonsentsjane – babies and pelosi
kommonsentsjane – baby
kommonsentsjane – baby parts vs confederate flag
kommonsentsjane – babylon
kommonsentsjane – back 9 of life
kommonsentsjane – bailout and law suits
kommonsentsjane – bakers silenced
kommonsentsjane – balloon belly diet
kommonsentsjane – baltimore
kommonsentsjane – baltimore cops
kommonsentsjane – baltimore mayor rawlings-blake
kommonsentsjane – ban muslims from usa
kommonsentsjane – ban on muslims
kommonsentsjane – ban the muslims until
kommonsentsjane – bank info
kommonsentsjane – banks
kommonsentsjane – banks and government
kommonsentsjane – banks soaking their customers
kommonsentsjane – banning muslim from the usa
kommonsentsjane – barack
kommonsentsjane – barack obama
kommonsentsjane – baracks ten commandments
kommonsentsjane – baracks ten oommandments
kommonsentsjane – barbara boxer
kommonsentsjane – barbra streisand
kommonsentsjane – bathrooms
kommonsentsjane – bbc reporter
kommonsentsjane – be alert
kommonsentsjane – beau
kommonsentsjane – beauty and the beast
kommonsentsjane – beck and trump
kommonsentsjane – before you vote – read this
kommonsentsjane – beggars on the street
kommonsentsjane – beheadings
kommonsentsjane – belated birthday greetings.
kommonsentsjane – belgium
kommonsentsjane – ben affleck
kommonsentsjane – ben carson
kommonsentsjane – benghazi
kommonsentsjane – benghazi – the rat trap
kommonsentsjane – benghazi continued
kommonsentsjane – benghazi no. 2
kommonsentsjane – benghazi survivors backing trump
kommonsentsjane – bernie sanders
kommonsentsjane – bernie sanders rally
kommonsentsjane – bernie sanders, muslim supporter
kommonsentsjane – bernies fairy tales
kommonsentsjane – bernies sanders popularity puzzle solved
kommonsentsjane – best of friends
kommonsentsjane – betrayed
kommonsentsjane – bettina trump has monaco outing with husband don jr. Amid first lady goal claims
kommonsentsjane – beyonce, super bowl
kommonsentsjane – bias against breeders
kommonsentsjane – biased media
kommonsentsjane – bible
kommonsentsjane – bible toter
kommonsentsjane – bibles for troops
kommonsentsjane – biden and obama
kommonsentsjane – big brother in the sky
kommonsentsjane – big joes polka party
kommonsentsjane – big mac sent back to u.S.
kommonsentsjane – bill and hillary
kommonsentsjane – bill and hillary clinton
kommonsentsjane – bill bennett
kommonsentsjane – bill clinton
kommonsentsjane – bill gates
kommonsentsjane – bill gates democracy vs socialism
kommonsentsjane – bill gates foundation
kommonsentsjane – bill oreilly
kommonsentsjane – bill warner
kommonsentsjane – bill/hillary clinton
kommonsentsjane – birds and poop
kommonsentsjane – birthday thanks
kommonsentsjane – bitcoins
kommonsentsjane – black christian woman court-martialed for bible verse on desk
kommonsentsjane – black conservatives speak out
kommonsentsjane – black lives matter disorder
kommonsentsjane – black lives matters
kommonsentsjane – black men
kommonsentsjane – black pastors meet with trump
kommonsentsjane – black vote and poverty
kommonsentsjane – black voters wising up
kommonsentsjane – black/asians work habits
kommonsentsjane – blackburn family
kommonsentsjane – blake shelton
kommonsentsjane – blessed virgin mary
kommonsentsjane – blessing of our pets
kommonsentsjane – blog
kommonsentsjane – blog publication
kommonsentsjane – bloomberg
kommonsentsjane – blue bell creameries
kommonsentsjane – boarding a plane in israel
kommonsentsjane – bob drank the kool-aid
kommonsentsjane – boehner
kommonsentsjane – bombed and burned catholic churches
kommonsentsjane – bombing oil fields
kommonsentsjane – booker t. Washington
kommonsentsjane – border children surprise – really?
kommonsentsjane – border illegal scam
kommonsentsjane – border patrol
kommonsentsjane – born in the u.S.A.
kommonsentsjane – both sides
kommonsentsjane – brett baird and the fox fat cats
kommonsentsjane – brigitte gabriel – the muslim brotherhood plan for america
kommonsentsjane – britain
kommonsentsjane – britains islam
kommonsentsjane – british government
kommonsentsjane – british man meets his waterloo
kommonsentsjane – british wwii cemetary
kommonsentsjane – brotherhood and gop
kommonsentsjane – buchanan to gop
kommonsentsjane – bucket list for 2016
kommonsentsjane – budget cuts
kommonsentsjane – buffets rule
kommonsentsjane – bush ii used eminent domain to build rangers texas ball park
kommonsentsjane – bush residence
kommonsentsjane – business and rfra
kommonsentsjane – business round table
kommonsentsjane – buying a miracle
kommonsentsjane – c.J. Pearson
kommonsentsjane – ca and ny trying to suppress and lie about climate change
kommonsentsjane – ca attackers
kommonsentsjane – ca terrorists
kommonsentsjane – california
kommonsentsjane – california vs texas
kommonsentsjane – called bail in
kommonsentsjane – calling all christians and non-christians who want to save their country.
kommonsentsjane – cam newton stands up to the media
kommonsentsjane – campaign finance reform
kommonsentsjane – campaign money
kommonsentsjane – can clinton beat trump
kommonsentsjane – canada celebrates hajeb day
kommonsentsjane – canada celebrates hijab day
kommonsentsjane – capitalism vs socialism
kommonsentsjane – captain ed w. Freeman
kommonsentsjane – car rules
kommonsentsjane – cardinal timothy dolan
kommonsentsjane – career politicians vs trump
kommonsentsjane – carly fiorina
kommonsentsjane – carly florina
kommonsentsjane – carson and islam
kommonsentsjane – ceo cooks diatribe
kommonsentsjane – chances and respect
kommonsentsjane – charity is not free
kommonsentsjane – charity or greed
kommonsentsjane – charlie brown
kommonsentsjane – charlie daniels
kommonsentsjane – chastising christians again
kommonsentsjane – chemo day
kommonsentsjane – cherokee lords prayer
kommonsentsjane – cheryl mills/hillary/clinton foundation classified emails
kommonsentsjane – chicago july 4 killings
kommonsentsjane – chicago killings – does anyone care for their fellow man – doesnt look like it.
kommonsentsjane – chief justice john roberts
kommonsentsjane – children
kommonsentsjane – children – out of the mouths of babes
kommonsentsjane – children and school
kommonsentsjane – children in gaza human shields
kommonsentsjane – children of gay parents
kommonsentsjane – china
kommonsentsjane – china hype
kommonsentsjane – chinese hack of opm
kommonsentsjane – chinese hackers break the code again
kommonsentsjane – chinese hacking problem
kommonsentsjane – chocolate
kommonsentsjane – choice abortion or life
kommonsentsjane – chris christie
kommonsentsjane – chris christie endorses trump
kommonsentsjane – chris kyle
kommonsentsjane – chris kyle funeral
kommonsentsjane – chris matthews and the race card
kommonsentsjane – christian churches burned in india
kommonsentsjane – christian genocide in the world
kommonsentsjane – christian in marines
kommonsentsjane – christian western vets join fight
kommonsentsjane – christianity and god
kommonsentsjane – christianity in america and the world
kommonsentsjane – christians
kommonsentsjane – christians and muslims
kommonsentsjane – christians drowned
kommonsentsjane – christmas
kommonsentsjane – christmas cards
kommonsentsjane – christmas classics and scenery
kommonsentsjane – christmas music
kommonsentsjane – chuck hagel
kommonsentsjane – chuck norris
kommonsentsjane – chuck norris and jade helm
kommonsentsjane – chuck schumer – slime in the ice machine
kommonsentsjane – church and state
kommonsentsjane – cia interrogation
kommonsentsjane – cia work force
kommonsentsjane – citizenship proof to vote
kommonsentsjane – citizenship test
kommonsentsjane – citizenship test answers
kommonsentsjane – city officials are failing the people
kommonsentsjane – civil asset forfeiture
kommonsentsjane – civil forfeitures
kommonsentsjane – civil war
kommonsentsjane – clean out the democrats and elites
kommonsentsjane – climate change
kommonsentsjane – climate change again
kommonsentsjane – climate change deal
kommonsentsjane – climate change professor
kommonsentsjane – climate change scandal
kommonsentsjane – clint eastwood and oscar boycotters
kommonsentsjane – clinton and sanders debate
kommonsentsjane – clinton foundation
kommonsentsjane – clinton is not a christian
kommonsentsjane – clinton vs trump
kommonsentsjane – clintons – lesson on charities
kommonsentsjane – clintons and black vote
kommonsentsjane – clintons definition of sexism
kommonsentsjane – clintons plan
kommonsentsjane – clintons
kommonsentsjane – clips of both sides of the immigration story
kommonsentsjane – club for growth vs trump
kommonsentsjane – cnn analyst
kommonsentsjane – co=pilot andreas lubitz
kommonsentsjane – coach joe kennedy
kommonsentsjane – coburn and manchin
kommonsentsjane – coddling is the new wave
kommonsentsjane – cognisense for all government employees
kommonsentsjane – collectibles
kommonsentsjane – college liberal professor
kommonsentsjane – college tuition
kommonsentsjane – collision of two trains
kommonsentsjane – collusion between elites, new york times, and buzzfeed
kommonsentsjane – cologne germany rapes
kommonsentsjane – commander in chief
kommonsentsjane – common core
kommonsentsjane – common sense vs math
kommonsentsjane – communism
kommonsentsjane – communists/progressives in america
kommonsentsjane – companies vs planned parenthood
kommonsentsjane – complaint
kommonsentsjane – computer games
kommonsentsjane – computer geeks
kommonsentsjane – computer gobal warming
kommonsentsjane – condensing obamacare
kommonsentsjane – confederate flag
kommonsentsjane – congress
kommonsentsjane – congress and its role
kommonsentsjane – congress and senate
kommonsentsjane – conservatives vs fox news
kommonsentsjane – constitution
kommonsentsjane – constitution and free speech
kommonsentsjane – constitution is law of the land
kommonsentsjane – constitution is on the line
kommonsentsjane – constitution not sharia
kommonsentsjane – constitution vs quran
kommonsentsjane – constitution vs the quran
kommonsentsjane – constitutional conservatves
kommonsentsjane – convention of states
kommonsentsjane – cop hater bill de blasio
kommonsentsjane – corrupt epa
kommonsentsjane – corrupt political allies
kommonsentsjane – court-martialed marine
kommonsentsjane – crash course needed
kommonsentsjane – credit bureaus
kommonsentsjane – credit where credit isnt due – obama
kommonsentsjane – crisis text line
kommonsentsjane – crists energy fan
kommonsentsjane – crossroads pac
kommonsentsjane – crusade statistics
kommonsentsjane – cruz and rubios and the poland workers
kommonsentsjane – cruz and rubios big bark
kommonsentsjane – cruz and rubios slug fest
kommonsentsjane – cruz and the elites
kommonsentsjane – cruz is blowing smoke
kommonsentsjane – cruz returns mitts rip
kommonsentsjane – cruz still bragging about cheating
kommonsentsjane – cruz vs carson – we disagree on accountability and culpability
kommonsentsjane – cruz vs trump
kommonsentsjane – cuba
kommonsentsjane – cursive writing instructions
kommonsentsjane – curtis parks
kommonsentsjane – dan patricks poem to soldiers
kommonsentsjane – dana loesch
kommonsentsjane – danger ahead says the feds
kommonsentsjane – dangerous vision
kommonsentsjane – darren wilson
kommonsentsjane – darth vader
kommonsentsjane – david and texas a&m
kommonsentsjane – david cameron
kommonsentsjane – david gergen says fox crossed the line.
kommonsentsjane – david petraeus
kommonsentsjane – daylight savings time in american
kommonsentsjane – de blasos bullying
kommonsentsjane – deadly kissing bug
kommonsentsjane – dean vs walker
kommonsentsjane – dear obama
kommonsentsjane – death tax on agenda
kommonsentsjane – debate
kommonsentsjane – debate – jeb bush
kommonsentsjane – debate of the past and present
kommonsentsjane – debate results
kommonsentsjane – debbie wasserman schultz
kommonsentsjane – decisions in life
kommonsentsjane – dedicated to all policemen
kommonsentsjane – defense bill
kommonsentsjane – definition of a thug
kommonsentsjane – defund planned parenthood
kommonsentsjane – defunding planned parenthood
kommonsentsjane – defying the constitution
kommonsentsjane – dem debate
kommonsentsjane – dems and hillarys emails
kommonsentsjane – dems barking up the wrong tree
kommonsentsjane – dems in dissaray
kommonsentsjane – democracy
kommonsentsjane – democracy under fire
kommonsentsjane – democrat candidates
kommonsentsjane – democrat debates
kommonsentsjane – democrat gone stray
kommonsentsjane – democrat race discussion still pending
kommonsentsjane – democrat war cry
kommonsentsjane – democrats new dept
kommonsentsjane – democratic debate
kommonsentsjane – democratic national committee
kommonsentsjane – democratic party
kommonsentsjane – democratic party and leader still silent
kommonsentsjane – democratic party taxes
kommonsentsjane – democrats
kommonsentsjane – democrats – deep partisan split
kommonsentsjane – democrats and elite republicans
kommonsentsjane – democrats and gun control
kommonsentsjane – democrats and obama
kommonsentsjane – democrats and obamas muslim idealogy
kommonsentsjane – democrats and the swamp
kommonsentsjane – democrats block refugee screening reform
kommonsentsjane – democrats have failed the country
kommonsentsjane – democrats hiding under the communist/muslim/socialists banner
kommonsentsjane – democrats leaving washington
kommonsentsjane – democrats regression
kommonsentsjane – democrats reject keyston
kommonsentsjane – democrats speak in iowa
kommonsentsjane – democrats war on women
kommonsentsjane – democrats war on women flap continues
kommonsentsjane – democratshave been hijacked by the communists
kommonsentsjane – denmark criminalizes free speech – selectively
kommonsentsjane – dennis hastert
kommonsentsjane – depopulation fanatics
kommonsentsjane – dept of homeland security
kommonsentsjane – deputy darren goforth killed
kommonsentsjane – dhs chief jeh johnson
kommonsentsjane – dhs official ordered to purge terrorists records
kommonsentsjane – dhs vote in senate/house
kommonsentsjane – diamond and silk say, not so fast
kommonsentsjane – dictatorship disguised as democracy
kommonsentsjane – did cruz swindle the evangelicals
kommonsentsjane – did cruz swindle the evangelicals in iowa
kommonsentsjane – did hillary steal iowa with the apps
kommonsentsjane – difference between assault and battery
kommonsentsjane – dillon taylor killed
kommonsentsjane – dinesh dsouza
kommonsentsjane – disabled vet tim poe blows us away with his singing
kommonsentsjane – dishonest and not trustworthy – but elected
kommonsentsjane – disney/jobs and e-verify
kommonsentsjane – ditka rips obama
kommonsentsjane – dividing the arabs
kommonsentsjane – dnc debbie wasserman schultz
kommonsentsjane – dnc donors in nh and ia
kommonsentsjane – do we really care
kommonsentsjane – do we really care – blue dress or someones birthday
kommonsentsjane – do you complain
kommonsentsjane – do you really need college
kommonsentsjane – do you speak spanish/english
kommonsentsjane – do you understand – which one are you
kommonsentsjane – does rubio have small hands
kommonsentsjane – dogs
kommonsentsjane – doj
kommonsentsjane – doj false flag
kommonsentsjane – doj on hot seat
kommonsentsjane – dont ever turn your back on your god or your country
kommonsentsjane – dont help build that communism wall
kommonsentsjane – dont vote for a democrat
kommonsentsjane – donald trump
kommonsentsjane – donald trump – the vicious snakes
kommonsentsjane – donald trump event
kommonsentsjane – donald trump interview
kommonsentsjane – donald trump makes public appearance but people are distracted by certain body parts.
kommonsentsjane – donald trump speaks
kommonsentsjane – donald trumps past catches up with him
kommonsentsjane – donald trumps political plans
kommonsentsjane – donald trumps political plans for america
kommonsentsjane – donna brazile
kommonsentsjane – doom and gloom?
kommonsentsjane – double rainbows
kommonsentsjane – dr. Ablow and ebola
kommonsentsjane – dr. Carson
kommonsentsjane – dr. Eowyn
kommonsentsjane – dr. James manning
kommonsentsjane – dr. James matting helping his people
kommonsentsjane – dr. Manning
kommonsentsjane – dr. Matting and sharpton
kommonsentsjane – dr. Paul mchugh
kommonsentsjane – drirector comey
kommonsentsjane – driver update is a scam
kommonsentsjane – drones
kommonsentsjane – dummies joke
kommonsentsjane – duncans ticket
kommonsentsjane – dutch soldiers training in austin tx
kommonsentsjane – easter greetings
kommonsentsjane – ebola and loose screws
kommonsentsjane – ebola and the after effects
kommonsentsjane – ebola and the truth
kommonsentsjane – ebola is a public health issue
kommonsentsjane – ebola problem is beamed up
kommonsentsjane – ebola protections
kommonsentsjane – ebola virus and who is looking out for the u.S.
kommonsentsjane – economy under obama and democrats failed
kommonsentsjane – education
kommonsentsjane – education and its pitfalls
kommonsentsjane – egypt
kommonsentsjane – egypt bombs isis in libya
kommonsentsjane – egyptian christian beheadings by isis
kommonsentsjane – egyptian tv
kommonsentsjane – election 2016
kommonsentsjane – election day change
kommonsentsjane – elections and the corruption of
kommonsentsjane – elections have consequences
kommonsentsjane – elite republicans new poll
kommonsentsjane – elite republicans
kommonsentsjane – elite republicans again ranting
kommonsentsjane – elites and cnn, msnbc harassing trump about the kkk
kommonsentsjane – elites trying to hijack we the people
kommonsentsjane – elites desperate measures
kommonsentsjane – elizabeth warren
kommonsentsjane – elon musk slams democrat betrayers for shamlessly denying support to election integrity bill.
kommonsentsjane – emad karakrah
kommonsentsjane – emily blunt
kommonsentsjane – end birth right citizenship
kommonsentsjane – end birth right citzenship
kommonsentsjane – england
kommonsentsjane – epa
kommonsentsjane – epa at work contaminating
kommonsentsjane – epa colorado spill
kommonsentsjane – epa employees at work
kommonsentsjane – epa over kill
kommonsentsjane – epas pattern of deception in colorado mine spill
kommonsentsjane – eric fanning
kommonsentsjane – escaping tyranny
kommonsentsjane – establishment republicans chose rubio after losing bush
kommonsentsjane – ethnic cleansing
kommonsentsjane – europe died in auschwitz
kommonsentsjane – europe is in trouble.
kommonsentsjane – europes mass immigration
kommonsentsjane – europe/syria
kommonsentsjane – european countries
kommonsentsjane – european union
kommonsentsjane – eve
kommonsentsjane – ex-general wesley clark
kommonsentsjane – executive orders/memoranda
kommonsentsjane – export-import bank
kommonsentsjane – facebook experiment
kommonsentsjane – facebook for the senior generation
kommonsentsjane – facts media doesnt spell out
kommonsentsjane – facts of life
kommonsentsjane – facts of rfra
kommonsentsjane – fake cease fires
kommonsentsjane – false prophet
kommonsentsjane – false prophets
kommonsentsjane – fam mobs
kommonsentsjane – family politics
kommonsentsjane – family visits
kommonsentsjane – farm subsidies and the presidential vote
kommonsentsjane – farook and hakim
kommonsentsjane – farrakhan
kommonsentsjane – father of benghazi soldier stands ground – hillary lied
kommonsentsjane – fawn deer
kommonsentsjane – fbi agents pummeling letter to holder
kommonsentsjane – fbi and hillary emails
kommonsentsjane – fbi and hillarys emails
kommonsentsjane – fbi director comey
kommonsentsjane – fbi vs the white house
kommonsentsjane – fed up hollywood veteran expose obama and democrats – gets a standing ovation!
kommonsentsjane – feds set revenue record but still run a deficit
kommonsentsjane – federal bureau of land mgmt
kommonsentsjane – federal court issues game changing ruling for voting in upcoming election
kommonsentsjane – federal programs
kommonsentsjane – federal reserve
kommonsentsjane – federal reserve secret tax payer funded 12 trillion bail out of banks
kommonsentsjane – fence on border
kommonsentsjane – ferguson needs to listen
kommonsentsjane – fergusons looting and burning
kommonsentsjane – fergusons paid protestors
kommonsentsjane – fifa world cup
kommonsentsjane – fifties eating
kommonsentsjane – fight to win terrorist war
kommonsentsjane – financial crisis
kommonsentsjane – fiorina – the full story
kommonsentsjane – fiorina and carson
kommonsentsjane – fiorina vs trump
kommonsentsjane – first christmas card
kommonsentsjane – first couples new years
kommonsentsjane – first lady
kommonsentsjane – first snow
kommonsentsjane – fit of anger
kommonsentsjane – flagger karen cooper
kommonsentsjane – flash mob dancing
kommonsentsjane – flesh eating bacteria
kommonsentsjane – flour for burns
kommonsentsjane – foia going to the dogs
kommonsentsjane – food preparation
kommonsentsjane – football
kommonsentsjane – football and sour grapes
kommonsentsjane – footballgate
kommonsentsjane – for your information houston repub debate
kommonsentsjane – force majeure
kommonsentsjane – foreign countries are interfering in americas election process
kommonsentsjane – foreign election money
kommonsentsjane – former state department ig says hillary lieing
kommonsentsjane – fort hood victim
kommonsentsjane – fort trumbull neighborhood
kommonsentsjane – fox and friends
kommonsentsjane – fox and friends sunday
kommonsentsjane – fox media
kommonsentsjane – fox news
kommonsentsjane – fox news and facebook
kommonsentsjane – fox news and the new world order
kommonsentsjane – fox news lies
kommonsentsjane – fox news media
kommonsentsjane – fox news quagmire
kommonsentsjane – fox news rupert murdoch attends fundraiser for hillary in london
kommonsentsjane – fox set-up
kommonsentsjane – foxs five program
kommonsentsjane – foxs roger ailes mocks trump
kommonsentsjane – france
kommonsentsjane – frances pc war with islam
kommonsentsjane – frances relentless hate for israel
kommonsentsjane – franklin graham
kommonsentsjane – freddie gray riots
kommonsentsjane – free coffee?
kommonsentsjane – free market capitalism
kommonsentsjane – free speech amendment
kommonsentsjane – free speech vs pc police
kommonsentsjane – freedom for all women
kommonsentsjane – freedom in the netherlands
kommonsentsjane – freedom of speech
kommonsentsjane – freedom or repression
kommonsentsjane – freeman vs the browns
kommonsentsjane – french food and entertainment
kommonsentsjane – friends
kommonsentsjane – from texas with love
kommonsentsjane – fund raisers?
kommonsentsjane – funding for violence in u.S. Communities
kommonsentsjane – gallego amendment
kommonsentsjane – gallery of socialists in america
kommonsentsjane – game of chess
kommonsentsjane – gandhi
kommonsentsjane – garner state park tx
kommonsentsjane – garth brooks and his low place
kommonsentsjane – geert wilders
kommonsentsjane – gender sensitivity training
kommonsentsjane – general odierno resigns from military
kommonsentsjane – general petraeus
kommonsentsjane – generation z
kommonsentsjane – george bush and 9/11
kommonsentsjane – george bushs comments on middle east
kommonsentsjane – george diaz
kommonsentsjane – george soros
kommonsentsjane – george soros and ferguson
kommonsentsjane – george soros invests in fire arms
kommonsentsjane – george soros, the open society rich man
kommonsentsjane – german mayor is a disgrace to women
kommonsentsjane – german migrant crime
kommonsentsjane – germanwings
kommonsentsjane – germanwings and lubitz update
kommonsentsjane – germanwings crash
kommonsentsjane – germany
kommonsentsjane – germany and israel
kommonsentsjane – germany refugees
kommonsentsjane – germanys christmas tradition
kommonsentsjane – germanys migrants
kommonsentsjane – get coffee
kommonsentsjane – ghosts and goblins
kommonsentsjane – ghosts and goblins – 3
kommonsentsjane – ghosts and goblins 2
kommonsentsjane – gibson guitars and the raid
kommonsentsjane – giddy up lerner
kommonsentsjane – gifts for any occasion
kommonsentsjane – gingrich – we are losing the war
kommonsentsjane – gitmo
kommonsentsjane – giuliani not a racist
kommonsentsjane – global warming
kommonsentsjane – global warming facts
kommonsentsjane – global warming lie
kommonsentsjane – global warming skeptics
kommonsentsjane – global warming versus beheadings
kommonsentsjane – global warmng
kommonsentsjane – gmo food labeling
kommonsentsjane – go for it, girl
kommonsentsjane – god
kommonsentsjane – god and guns
kommonsentsjane – gold
kommonsentsjane – golf and sex
kommonsentsjane – golf and the miind game
kommonsentsjane – golf and the raging wars
kommonsentsjane – golf course is calling obama
kommonsentsjane – goodbye beau
kommonsentsjane – google
kommonsentsjane – gop congress
kommonsentsjane – gop elites blow $65 million on jeb bush and his failed campaign
kommonsentsjane – gov roy cooper – nc – states that joe biden saved this nation. That is a lie.
kommonsentsjane – gov. Christie
kommonsentsjane – government
kommonsentsjane – government bad apples
kommonsentsjane – government budget 2016 – no increased spending
kommonsentsjane – government interfering with furniture buying
kommonsentsjane – government land grab
kommonsentsjane – government waste of taxpayers money
kommonsentsjane – governments scare tactics
kommonsentsjane – governor haley
kommonsentsjane – governor jindal
kommonsentsjane – governor perry vs the keep austin weird socialist democrats
kommonsentsjane – governor-elect letter to vets
kommonsentsjane – gowdy for speaker
kommonsentsjane – graduation rates
kommonsentsjane – graham and rubio no shows for vote
kommonsentsjane – grandpa and the wooden bowl
kommonsentsjane – grandpa farrakhan
kommonsentsjane – great britain
kommonsentsjane – gruber vs cia
kommonsentsjane – guess where in the world former ag holder is working
kommonsentsjane – gun common sense
kommonsentsjane – gun control and family
kommonsentsjane – gun free zones
kommonsentsjane – gun rights abuse by president
kommonsentsjane – gun rights attack
kommonsentsjane – gun safe areas
kommonsentsjane – guns
kommonsentsjane – guns and democrats
kommonsentsjane – guns and gold
kommonsentsjane – guns and the second amendment
kommonsentsjane – hamas inhuman treatment of children/families
kommonsentsjane – hamas propaganda war
kommonsentsjane – hammond ranch
kommonsentsjane – hands
kommonsentsjane – hands up
kommonsentsjane – happy new years
kommonsentsjane – happy thanksgiving
kommonsentsjane – hard to believe
kommonsentsjane – harold b estes
kommonsentsjane – harry reid
kommonsentsjane – hate speech
kommonsentsjane – have you ever had a gratitude attack
kommonsentsjane – hayden and islam terrorists
kommonsentsjane – hazard travelling
kommonsentsjane – healing therapy
kommonsentsjane – heaven
kommonsentsjane – heaven forbid – obamas permanent residency
kommonsentsjane – help wanted
kommonsentsjane – help wanted ad
kommonsentsjane – hill and bill clinton
kommonsentsjane – hillary
kommonsentsjane – hillary and abedin
kommonsentsjane – hillary and benghazi
kommonsentsjane – hillary and bill cliinton
kommonsentsjane – hillary and bill clinton
kommonsentsjane – hillary and donations
kommonsentsjane – hillary and high crimes
kommonsentsjane – hillary and obama
kommonsentsjane – hillary and obama failed
kommonsentsjane – hillary and responsibility
kommonsentsjane – hillary and soros
kommonsentsjane – hillary and the chinese
kommonsentsjane – hillary and the three bears
kommonsentsjane – hillary and waco
kommonsentsjane – hillary cliinton
kommonsentsjane – hillary clinton
kommonsentsjane – hillary clinton and benghazi
kommonsentsjane – hillary clinton and bernie sanders debate
kommonsentsjane – hillary clinton and huma abedin
kommonsentsjane – hillary clinton and joe biden
kommonsentsjane – hillary clinton baggage
kommonsentsjane – hillary clinton campaign uses rope a dope system
kommonsentsjane – hillary clinton email exceed top secret
kommonsentsjane – hillary clinton ipad and iphone
kommonsentsjane – hillary clinton says second amendment is hog wash
kommonsentsjane – hillary clinton the energy bunny
kommonsentsjane – hillary clinton vs donald trump
kommonsentsjane – hillary clintons list of pay checks
kommonsentsjane – hillary confirmed – she will continue obamas policies
kommonsentsjane – hillary exposed
kommonsentsjane – hillary has been violated
kommonsentsjane – hillary interview
kommonsentsjane – hillary is guilty
kommonsentsjane – hillary is guilty for lieing
kommonsentsjane – hillary often confused
kommonsentsjane – hillary on trump, a wave, smile
kommonsentsjane – hillary using bills modern math
kommonsentsjane – hillary vs petraeus
kommonsentsjane – hillary vs trump
kommonsentsjane – hillarys bathroom story
kommonsentsjane – hillarys benghazi
kommonsentsjane – hillarys control bill plan
kommonsentsjane – hillarys dogging emails
kommonsentsjane – hillarys emails – diamond and silk
kommonsentsjane – hillarys liar statement
kommonsentsjane – hillarys lies
kommonsentsjane – hillarys marxist agenda
kommonsentsjane – hillarys muslim heritage
kommonsentsjane – hillarys muslim influence
kommonsentsjane – hillarys stand-down order never came
kommonsentsjane – hillarys win a loss for the democrats
kommonsentsjane – hillarys wussification of america
kommonsentsjane – hillary/bill clinton
kommonsentsjane – hispanic gala and obama
kommonsentsjane – history
kommonsentsjane – history of the confederate flag
kommonsentsjane – hogs in michigan
kommonsentsjane – holiday
kommonsentsjane – holidays
kommonsentsjane – holier than thou media and bush
kommonsentsjane – hollande declares war on isis
kommonsentsjane – hollywood
kommonsentsjane – hollywood and the fantasy movies
kommonsentsjane – holmes-norton bill
kommonsentsjane – home is where the heart is
kommonsentsjane – homegrown muslim terrorists
kommonsentsjane – homeland security bimbp
kommonsentsjane – homeland security funding
kommonsentsjane – honebee colonies
kommonsentsjane – hope and change
kommonsentsjane – hope springs eternal
kommonsentsjane – houston mayor pushing lesbian agenda
kommonsentsjane – houstons bathroom bill failed
kommonsentsjane – how dare the serfs complain
kommonsentsjane – how democrats are changing our country into a social country
kommonsentsjane – how democrats are implementing the communists’ plan to destroy america
kommonsentsjane – how did rubio get 23% – are upi surprised
kommonsentsjane – how inspiring
kommonsentsjane – how not to stop a terrorist attack
kommonsentsjane – how our reps work in d.C.
kommonsentsjane – how should you vote
kommonsentsjane – how the iowa caucus works
kommonsentsjane – hpuse gop
kommonsentsjane – hr 4138 – protection for the people
kommonsentsjane – hr 4138 enforce law act video
kommonsentsjane – huffington post
kommonsentsjane – huffington post rags on trump
kommonsentsjane – huma abedin
kommonsentsjane – huma abedin ties to hillary
kommonsentsjane – humba abedin
kommonsentsjane – hungary
kommonsentsjane – hunting and fishing rights.
kommonsentsjane – i am afraid. Terribly afraid.
kommonsentsjane – i dont believe i have every lied – cough cough
kommonsentsjane – i smell a rat
kommonsentsjane – i will vote for that.
kommonsentsjane – i won twice
kommonsentsjane – ice officer says rubio lied to the american people
kommonsentsjane – ices red line
kommonsentsjane – identity
kommonsentsjane – identity politics is causing a war among feminists
kommonsentsjane – if you support a third party candidate to dump trump your are voting for clinton
kommonsentsjane – illegal citizenship drive
kommonsentsjane – illegal deportation
kommonsentsjane – illegal immigrants
kommonsentsjane – illegal immigrants and sanctuary cities
kommonsentsjane – illegal immigration
kommonsentsjane – illegal immigration cover up
kommonsentsjane – illegals
kommonsentsjane – imans in america
kommonsentsjane – imf
kommonsentsjane – imf announcement coming
kommonsentsjane – imf global tax
kommonsentsjane – immigrants
kommonsentsjane – immigration
kommonsentsjane – immigration and open borders
kommonsentsjane – immigration and texas legislative session
kommonsentsjane – immigration in europe and america
kommonsentsjane – immigration stay
kommonsentsjane – immigration vs border patrol agents
kommonsentsjane – immigration with jose diaz balart
kommonsentsjane – importance of drinking water
kommonsentsjane – in god we still trust song by diamond rio
kommonsentsjane – income/wealth inequality
kommonsentsjane – incompetent irs again
kommonsentsjane – indiana
kommonsentsjane – inflation
kommonsentsjane – inflation plummeting – data shows.
kommonsentsjane – inflation plummeting – new data shows.
kommonsentsjane – injustice during war time
kommonsentsjane – innocent children
kommonsentsjane – intellectual state of emergency
kommonsentsjane – internal war in the democratic party
kommonsentsjane – international community ignorance
kommonsentsjane – internet alert
kommonsentsjane – internet management
kommonsentsjane – internet pay off
kommonsentsjane – internet take over
kommonsentsjane – iowa caucus
kommonsentsjane – iowa caucus issues and answers
kommonsentsjane – iowa caucus votes
kommonsentsjane – iran
kommonsentsjane – iran and isil
kommonsentsjane – iran bad deal
kommonsentsjane – iran deal
kommonsentsjane – iran deal and senate
kommonsentsjane – iran deal protest
kommonsentsjane – iran rockets
kommonsentsjane – irans bad deal
kommonsentsjane – irans leader
kommonsentsjane – irans path to bomb
kommonsentsjane – iranian soccer
kommonsentsjane – iraq and iran
kommonsentsjane – iraq christians vs isis
kommonsentsjane – iraq prime minister
kommonsentsjane – iraqs money and the isis thieves
kommonsentsjane – irs
kommonsentsjane – irs and targeting
kommonsentsjane – irs is at it again
kommonsentsjane – irs targeting
kommonsentsjane – irs vs citizen
kommonsentsjane – is democracy temporary
kommonsentsjane – is donald trump a bad person
kommonsentsjane – is fox admitting they are not fair and balanced by dropping rubio
kommonsentsjane – is isis really here in u.S.?
kommonsentsjane – is obama judas in the bible
kommonsentsjane – is the left even on americas side anymore
kommonsentsjane – is the mystery unfolding
kommonsentsjane – is the taliban the enemy
kommonsentsjane – is this a hit piece or unbiased jounalism
kommonsentsjane – is this a joke?
kommonsentsjane – is this equality
kommonsentsjane – is this fakery
kommonsentsjane – is un so busy watching israel they give putin a pass
kommonsentsjane – isil raid
kommonsentsjane – isis
kommonsentsjane – isis and selfie
kommonsentsjane – isis behavior
kommonsentsjane – isis camp
kommonsentsjane – isis in america
kommonsentsjane – isis in syria
kommonsentsjane – isis killiing children
kommonsentsjane – isis manual
kommonsentsjane – isis vs isil
kommonsentsjane – isis vs obama
kommonsentsjane – isis threat to america
kommonsentsjane – islam
kommonsentsjane – islam and fluff
kommonsentsjane – islam and islamism in america
kommonsentsjane – islam and other religions
kommonsentsjane – islam questions and answers
kommonsentsjane – islamic colonization
kommonsentsjane – islamic terrorism
kommonsentsjane – islamist genocide
kommonsentsjane – islamophobia
kommonsentsjane – isnt it ironic?
kommonsentsjane – israel
kommonsentsjane – israel and palestine war
kommonsentsjane – israel vs palestinians
kommonsentsjane – israels election
kommonsentsjane – israels pm netanyahu
kommonsentsjane – it has never been easier to vote in america. So why the lefts meltdown?
kommonsentsjane – it has never been easier to vote in america. So why the lefts meltdown?
kommonsentsjane – it is not sick, it is inhuman
kommonsentsjane – jack nicholson
kommonsentsjane – jackson lee vs scalise
kommonsentsjane – jade helm
kommonsentsjane – jade helm 15
kommonsentsjane – jade helm 15 contd
kommonsentsjane – jade helm 2015
kommonsentsjane – jade helm drill – 2
kommonsentsjane – jade helm drill – 3
kommonsentsjane – jade helm drill 1
kommonsentsjane – jade helm follow-up
kommonsentsjane – jade helm kick-off
kommonsentsjane – james comey and racism
kommonsentsjane – janet yellen
kommonsentsjane – jay nixon
kommonsentsjane – jay sekulow
kommonsentsjane – jeb and george bush
kommonsentsjane – jeb bush
kommonsentsjane – jeb bush – new judge not important to him
kommonsentsjane – jeb bush calling in reinforcements
kommonsentsjane – jeb bush casting stones
kommonsentsjane – jeb bush interfering with florida primary
kommonsentsjane – jeb bushs common core
kommonsentsjane – jebs ragging
kommonsentsjane – jebbies own imminent domain
kommonsentsjane – jeff sessions endorsed trump
kommonsentsjane – jeff zucker and axelrod
kommonsentsjane – jeh johnson
kommonsentsjane – jerry brown
kommonsentsjane – jesus
kommonsentsjane – jewish people
kommonsentsjane – jewish voters
kommonsentsjane – jihad
kommonsentsjane – jihadi john
kommonsentsjane – jihadists
kommonsentsjane – jihadists in syria
kommonsentsjane – jihadists promise
kommonsentsjane – jim webb
kommonsentsjane – jindal at 2%
kommonsentsjane – jobs
kommonsentsjane – jobs and government
kommonsentsjane – jobs in u.S.
kommonsentsjane – joe biden
kommonsentsjane – joe manchin
kommonsentsjane – john boehner
kommonsentsjane – john brennan
kommonsentsjane – john kasich george soros donor
kommonsentsjane – john kasichs bully parade, romney
kommonsentsjane – john kerry
kommonsentsjane – john mccain
kommonsentsjane – john sununu
kommonsentsjane – johnn koskinen
kommonsentsjane – jon stewart
kommonsentsjane – jon stewarts farewell
kommonsentsjane – jorge ramos
kommonsentsjane – joseph botts
kommonsentsjane – journalistic incest
kommonsentsjane – joy reid – our country will suffer king trump and project 2025.
kommonsentsjane – judge initiates investigation into obamas false social security number
kommonsentsjane – judge jeanines plan
kommonsentsjane – judge nails leader
kommonsentsjane – judges and kick backs
kommonsentsjane – judicial activism
kommonsentsjane – judicial watch
kommonsentsjane – judicial watch and american civil liberties justice are helping america since the justice dept has failed the american people
kommonsentsjane – julian castro (not fidel)
kommonsentsjane – july 4th in indonesia
kommonsentsjane – just a common soldier
kommonsentsjane – just doodling
kommonsentsjane – just had to send
kommonsentsjane – just obey the law
kommonsentsjane – just trucking along
kommonsentsjane – just where do you stand in he election
kommonsentsjane – justice antonin scalias death
kommonsentsjane – justice dept
kommonsentsjane – justice dept sponsors video
kommonsentsjane – justice scalias death
kommonsentsjane – karen gray
kommonsentsjane – karl rove
kommonsentsjane – karzais thanks to u.S.
kommonsentsjane – kasich vs trump
kommonsentsjane – kate steinle
kommonsentsjane – kent state and islam
kommonsentsjane – kenya and obama
kommonsentsjane – kerry lieing again
kommonsentsjane – kerrys bad deal
kommonsentsjane – keystone pipeline
kommonsentsjane – khamenei
kommonsentsjane – khobar towers bombings
kommonsentsjane – killers spokesperson
kommonsentsjane – kim davis
kommonsentsjane – kindness and the jerusalem skin bank
kommonsentsjane – kommonsentsjane – time for a change in washington – vote for the people not the cartel (rubio, cruz, kasich)
kommonsentsjane – krauthammer is ringing the bell
kommonsentsjane – lack of leadership
kommonsentsjane – lack of reporting
kommonsentsjane – lady liberty
kommonsentsjane – landrieus senate seat
kommonsentsjane – lannie davis
kommonsentsjane – lanny davis
kommonsentsjane – latest news
kommonsentsjane – laughable poll numbers – liars
kommonsentsjane – lawmakers
kommonsentsjane – laws for texas courts
kommonsentsjane – leader begging for women votes
kommonsentsjane – leaders of the world
kommonsentsjane – lets kick butt in 2016
kommonsentsjane – lets party
kommonsentsjane – letter from the leader
kommonsentsjane – letter home
kommonsentsjane – letter to gop
kommonsentsjane – letter to our leader
kommonsentsjane – liberal college professors are harassing students
kommonsentsjane – liberal latino haters
kommonsentsjane – liberal media
kommonsentsjane – liberal poll company
kommonsentsjane – liberal professors
kommonsentsjane – liberals
kommonsentsjane – liberals collide
kommonsentsjane – library books
kommonsentsjane – life
kommonsentsjane – life and school
kommonsentsjane – life is a bitch truck
kommonsentsjane – life is a miracle
kommonsentsjane – lifes stories
kommonsentsjane – limbaughs theorem
kommonsentsjane – lindsey graham
kommonsentsjane – lipstick on a pig
kommonsentsjane – list of 97 taxes americans pay
kommonsentsjane – list of broken laws
kommonsentsjane – list of sanctuary cities in the u.S.
kommonsentsjane – listen to the past
kommonsentsjane – little jimmy
kommonsentsjane – live anthrax shipped
kommonsentsjane – living and teaching character
kommonsentsjane – living life
kommonsentsjane – living off the grid
kommonsentsjane – lohan
kommonsentsjane – lois lerner
kommonsentsjane – lookin for the gipper
kommonsentsjane – looking at the candidates
kommonsentsjane – looters/lockdowners/and the law.
kommonsentsjane – loretta lynch
kommonsentsjane – los angeles city ordinance
kommonsentsjane – lou dobbs
kommonsentsjane – lou holtz
kommonsentsjane – love and leadership
kommonsentsjane – love gone sour
kommonsentsjane – love me, im a liberal
kommonsentsjane – lt. Gen. Vincent stewart
kommonsentsjane – lucky the dog
kommonsentsjane – luis amnesty problems
kommonsentsjane – luv governor rep mark sanford endorses cruz – oops
kommonsentsjane – lying and the 10 commandments
kommonsentsjane – madeleine albrights statement
kommonsentsjane – madeline albright
kommonsentsjane – magic
kommonsentsjane – main street media
kommonsentsjane – main street media/democrats continue to slash and burn
kommonsentsjane – maine pokes work back into welfare
kommonsentsjane – make america great again
kommonsentsjane – mama and papa
kommonsentsjane – mama bush campaigning for jebbie
kommonsentsjane – man and money
kommonsentsjane – man versus woman verbiage
kommonsentsjane – manage the leader
kommonsentsjane – manfacturing
kommonsentsjane – manners
kommonsentsjane – many tears for children
kommonsentsjane – marco rubio
kommonsentsjane – marco rubio and trey gowdy
kommonsentsjane – marco rubio, poor little rich boy
kommonsentsjane – margaret thatcher
kommonsentsjane – marine
kommonsentsjane – marines targeted
kommonsentsjane – mark meadows
kommonsentsjane – market crash
kommonsentsjane – marriage
kommonsentsjane – martial law?
kommonsentsjane – matthews and maher
kommonsentsjane – maureen dowd on obama
kommonsentsjane – mayor de blasio
kommonsentsjane – mayor deblasio
kommonsentsjane – mccain fighting own party
kommonsentsjane – mcchrystal
kommonsentsjane – mcconnell taking the low road
kommonsentsjane – mcconnell trying to sneak a military martial law bill thru
kommonsentsjane – mcconnells failure over and over
kommonsentsjane – mcconnell, a socialist, taking the low road with the hillary
kommonsentsjane – mclellans money
kommonsentsjane – me and my .357
kommonsentsjane – media and newspapers
kommonsentsjane – media and non-belivers
kommonsentsjane – media bias
kommonsentsjane – media distort news
kommonsentsjane – media gives bushey no. 2 spot
kommonsentsjane – media hoaxes
kommonsentsjane – media matters
kommonsentsjane – media rigging again
kommonsentsjane – media vs men and women
kommonsentsjane – medical care and corruption
kommonsentsjane – meet the press and obama
kommonsentsjane – megapolitics
kommonsentsjane – melissa click
kommonsentsjane – memorial day tribute
kommonsentsjane – men and women bath rooms
kommonsentsjane – mending the nation
kommonsentsjane – mental stability in the white house?
kommonsentsjane – merry christmas
kommonsentsjane – merry christmas to our solders
kommonsentsjane – message to people to voted for obama twice
kommonsentsjane – messianic rabbi
kommonsentsjane – methane emissions regulations
kommonsentsjane – mexican children used as pawns
kommonsentsjane – mexican government and the pope
kommonsentsjane – mexican shooter in san francisco
kommonsentsjane – mexico vs obama
kommonsentsjane – mexicos immigration
kommonsentsjane – mexifornia
kommonsentsjane – michael savage
kommonsentsjane – michelle obama
kommonsentsjane – michigans civil forfeitures seizures
kommonsentsjane – microsfot apps fail in some areas in iowa
kommonsentsjane – microsoft furnishing software for caucus
kommonsentsjane – middle east
kommonsentsjane – middle east and terrorism
kommonsentsjane – middle east democracy
kommonsentsjane – middle east destruction
kommonsentsjane – migrants
kommonsentsjane – mike huckabee
kommonsentsjane – military
kommonsentsjane – military and hostile environment
kommonsentsjane – military dog
kommonsentsjane – military dogs
kommonsentsjane – military info
kommonsentsjane – military oaths
kommonsentsjane – military officers
kommonsentsjane – military pay
kommonsentsjane – military reporting in
kommonsentsjane – military speaks out
kommonsentsjane – militarys low morale
kommonsentsjane – militias
kommonsentsjane – millennials and adulthood
kommonsentsjane – mind over matter
kommonsentsjane – missing clinton email claims saudis involved
kommonsentsjane – missouri
kommonsentsjane – mitch mcconnell
kommonsentsjane – mitch mcconnell is a disgrace to america
kommonsentsjane – mitt romney
kommonsentsjane – mitt romney and the elite republicans are socialists
kommonsentsjane – mitt romney the elite republican bomb thrower
kommonsentsjane – mitt romney using harry reids age-old logic – did you beat your wife for the last ten years
kommonsentsjane – mizzou and yale colleges
kommonsentsjane – mom looking for son
kommonsentsjane – money and things
kommonsentsjane – monica lewis dies
kommonsentsjane – monkeys
kommonsentsjane – morally repugnant
kommonsentsjane – more fraud
kommonsentsjane – more gun control
kommonsentsjane – more hillary lies
kommonsentsjane – more illegal immigration with pen and phone
kommonsentsjane – more info on russian troops
kommonsentsjane – more jade helm
kommonsentsjane – more muslim problems
kommonsentsjane – more power to donald trump
kommonsentsjane – more problems not less
kommonsentsjane – more refugees
kommonsentsjane – more warren lies
kommonsentsjane – morocco bans exodus
kommonsentsjane – mosques in texas
kommonsentsjane – most dangerous cities
kommonsentsjane – mother teresa
kommonsentsjane – motivation and inspiration
kommonsentsjane – mt. Mckinley
kommonsentsjane – multi-culturalism
kommonsentsjane – muslim assignment
kommonsentsjane – muslim brotherhood
kommonsentsjane – muslim cannibals
kommonsentsjane – muslim cartoons
kommonsentsjane – muslim countries should play primary role in the war in the middle east
kommonsentsjane – muslim democratic debate
kommonsentsjane – muslim doctrine
kommonsentsjane – muslim facilties
kommonsentsjane – muslim holday
kommonsentsjane – muslim immigration
kommonsentsjane – muslim reform movement
kommonsentsjane – muslim religion
kommonsentsjane – muslim sign
kommonsentsjane – muslim terrorists in paris
kommonsentsjane – muslim weapons and bomb cache found
kommonsentsjane – muslims quran
kommonsentsjane – muslims
kommonsentsjane – muslims and arabs
kommonsentsjane – muslims and food stamps
kommonsentsjane – muslims and marriage
kommonsentsjane – muslims and obama
kommonsentsjane – muslims are acting like nazis
kommonsentsjane – muslims in america
kommonsentsjane – muslims in conflict with constitution
kommonsentsjane – muslims in tx
kommonsentsjane – muslims living in a democratic society
kommonsentsjane – muslims persecuting christians
kommonsentsjane – muslims slaughtering christians
kommonsentsjane – muslims thinking
kommonsentsjane – my high horse
kommonsentsjane – my song
kommonsentsjane – my song – here comes my baby by dottie west
kommonsentsjane – my songs
kommonsentsjane – mysterious crop formations
kommonsentsjane – naacp
kommonsentsjane – nafta
kommonsentsjane – nancy and ronald reagan
kommonsentsjane – nancy pelosi
kommonsentsjane – nanjing 2014 youth olympics
kommonsentsjane – nation building
kommonsentsjane – nation of islam
kommonsentsjane – national defense authorization act
kommonsentsjane – national guard soldiers
kommonsentsjane – national review needs to butt out
kommonsentsjane – national reviews insults on true conservatives
kommonsentsjane – national white people month
kommonsentsjane – native americans
kommonsentsjane – natures remedies
kommonsentsjane – navy chaplain modder
kommonsentsjane – navy commander found guilty of corruption
kommonsentsjane – navy seal
kommonsentsjane – navy seals say there arent enough rifles to go around have to share
kommonsentsjane – nazi gold train
kommonsentsjane – nba pushing gun control
kommonsentsjane – nbc and guthre
kommonsentsjane – nbc and republican debate
kommonsentsjane – nbc vs trump
kommonsentsjane – need to audit americas gold reserve
kommonsentsjane – need to keep and re-enforce our right to bear arms
kommonsentsjane – neil young
kommonsentsjane – net neutrality
kommonsentsjane – net un-neutrality
kommonsentsjane – netanyahu
kommonsentsjane – netanyahu and the radical muslims
kommonsentsjane – netanyahus speech
kommonsentsjane – new american religious sect going to iran
kommonsentsjane – new city in new york
kommonsentsjane – new disease called global warming
kommonsentsjane – new drug
kommonsentsjane – new executive order
kommonsentsjane – new gate keepers
kommonsentsjane – new government pay scale
kommonsentsjane – new judge
kommonsentsjane – new leadership is needed
kommonsentsjane – new movie – called the hoax
kommonsentsjane – new prison camp
kommonsentsjane – new suit and fun raiser
kommonsentsjane – new world order chaos
kommonsentsjane – new york
kommonsentsjane – new york and california
kommonsentsjane – new york police killings
kommonsentsjane – new york rag socialist times oldpapers news
kommonsentsjane – new york times
kommonsentsjane – new zealands children christmas story
kommonsentsjane – news media whining and lieing
kommonsentsjane – newspaper faux pas
kommonsentsjane – newsweek magazine closes
kommonsentsjane – newt gingrich
kommonsentsjane – next step in benghazi hearing
kommonsentsjane – nfl and whose to blame
kommonsentsjane – nigel farages speech
kommonsentsjane – nikki haley
kommonsentsjane – no appreciation
kommonsentsjane – no confederate cake; but isis cake okay
kommonsentsjane – no experienced needed
kommonsentsjane – no go areas
kommonsentsjane – no gun rights for americans per hillary
kommonsentsjane – no habitate just want to urinate
kommonsentsjane – no morals in politics – mitt the scoundrel.
kommonsentsjane – no power in d.C.
kommonsentsjane – no shower for 12 years
kommonsentsjane – no weakling
kommonsentsjane – noose in nascar drivers stall was a garage pull rope: fbi
kommonsentsjane – normandy d-day
kommonsentsjane – northeastern weather forecasts
kommonsentsjane – norton claims you dont
kommonsentsjane – not too late
kommonsentsjane – nothing but smoke and mirrors for clinton, bush, rubio
kommonsentsjane – nothing but terrorists
kommonsentsjane – nra
kommonsentsjane – nuclear iran – really
kommonsentsjane – numbers usa
kommonsentsjane – nunn on wrong track
kommonsentsjane – odonnell and trump challenge
kommonsentsjane – oreilly and his war on women
kommonsentsjane – oreilly vs will
kommonsentsjane – obama
kommonsentsjane – obama absent
kommonsentsjane – obama and 401ks
kommonsentsjane – obama and abortion rights
kommonsentsjane – obama and castros mcmansion
kommonsentsjane – obama and clausewitz
kommonsentsjane – obama and clintons
kommonsentsjane – obama and democratic party
kommonsentsjane – obama and disappointment
kommonsentsjane – obama and elections
kommonsentsjane – obama and gun rights
kommonsentsjane – obama and hillary
kommonsentsjane – obama and hillarys isis
kommonsentsjane – obama and history
kommonsentsjane – obama and holder
kommonsentsjane – obama and internet
kommonsentsjane – obama and michelle
kommonsentsjane – obama and muslim brotherood
kommonsentsjane – obama and muslims
kommonsentsjane – obama and oil
kommonsentsjane – obama and petty politics
kommonsentsjane – obama and pigs
kommonsentsjane – obama and slavery
kommonsentsjane – obama and terrorism
kommonsentsjane – obama and the 2nd amendment
kommonsentsjane – obama and the affordable plumbing act
kommonsentsjane – obama and the democratic party
kommonsentsjane – obama and the mystery ring
kommonsentsjane – obama and the pope
kommonsentsjane – obama and the race card
kommonsentsjane – obama and tragedy
kommonsentsjane – obama and truth
kommonsentsjane – obama and un refugees
kommonsentsjane – obama and warren
kommonsentsjane – obama apologizes
kommonsentsjane – obama as the jerk
kommonsentsjane – obama bashing
kommonsentsjane – obama breaking the law
kommonsentsjane – obama brings dish to dinner
kommonsentsjane – obama cooks the books again
kommonsentsjane – obama critizes gop
kommonsentsjane – obama cuts in military
kommonsentsjane – obama cutting border surveillance in half
kommonsentsjane – obama defies supreme court
kommonsentsjane – obama defying the will of the people
kommonsentsjane – obama drama
kommonsentsjane – obama finds a way to blame republican for baltimore, md
kommonsentsjane – obama gun policy is dangerous
kommonsentsjane – obama has ruled as a king not as president
kommonsentsjane – obama has wreaked havoc on america
kommonsentsjane – obama in full campaign mode
kommonsentsjane – obama is using illegals for votes
kommonsentsjane – obama lieing again
kommonsentsjane – obama lies
kommonsentsjane – obama lies again
kommonsentsjane – obama loses his voice
kommonsentsjane – obama lying to the people
kommonsentsjane – obama release convicts
kommonsentsjane – obama rhetoric
kommonsentsjane – obama rules
kommonsentsjane – obama sinking
kommonsentsjane – obama summit
kommonsentsjane – obama the absent minded professor
kommonsentsjane – obama the obstructionist
kommonsentsjane – obama un speech
kommonsentsjane – obama vs courts
kommonsentsjane – obama vs judicial watch
kommonsentsjane – obama vs police
kommonsentsjane – obama vs stamdards
kommonsentsjane – obama vs the iran deal
kommonsentsjane – obama vs the jewish people
kommonsentsjane – obama vs the states
kommonsentsjane – obama vs trump
kommonsentsjane – obama wants to dump more muslims in u.S.
kommonsentsjane – obama wishes
kommonsentsjane – obama with npr
kommonsentsjane – obamas bay of pigs
kommonsentsjane – obamas big speech
kommonsentsjane – obamas boat
kommonsentsjane – obamas brain trust
kommonsentsjane – obamas campaign
kommonsentsjane – obamas challenge
kommonsentsjane – obamas chastising
kommonsentsjane – obamas clean power act
kommonsentsjane – obamas climate change
kommonsentsjane – obamas constitution
kommonsentsjane – obamas debt
kommonsentsjane – obamas democratic party failed policies
kommonsentsjane – obamas disapproval
kommonsentsjane – obamas discussing isis
kommonsentsjane – obamas droning
kommonsentsjane – obamas egg shortage
kommonsentsjane – obamas epa dump
kommonsentsjane – obamas fears about trump drive his stepped up campaigning. Incredibly desperate dems use obamas in attempt to change the subject on harris record, gop senator says.
kommonsentsjane – obamas fence jumper
kommonsentsjane – obamas foreign policy
kommonsentsjane – obamas gift
kommonsentsjane – obamas guantanamo containment plans
kommonsentsjane – obamas gun grab
kommonsentsjane – obamas gun grab speeches
kommonsentsjane – obamas helpers
kommonsentsjane – obamas hype
kommonsentsjane – obamas immigration
kommonsentsjane – obamas iran advisor
kommonsentsjane – obamas iran deal
kommonsentsjane – obamas isis
kommonsentsjane – obamas islam
kommonsentsjane – obamas last budget
kommonsentsjane – obamas legacy
kommonsentsjane – obamas list
kommonsentsjane – obamas meme
kommonsentsjane – obamas military strategy
kommonsentsjane – obamas open borders
kommonsentsjane – obamas paris meeting
kommonsentsjane – obamas performance
kommonsentsjane – obamas police force
kommonsentsjane – obamas policies
kommonsentsjane – obamas ragging
kommonsentsjane – obamas real name
kommonsentsjane – obamas redux climate change
kommonsentsjane – obamas sanctuary cities
kommonsentsjane – obamas ship
kommonsentsjane – obamas speech
kommonsentsjane – obamas state of the bull
kommonsentsjane – obamas state of the union
kommonsentsjane – obamas statement on trump
kommonsentsjane – obamas strategy
kommonsentsjane – obamas terrorists
kommonsentsjane – obamas thanksgiving.
kommonsentsjane – obamas threats
kommonsentsjane – obamas trail fest
kommonsentsjane – obamas un speech
kommonsentsjane – obamas up bringing
kommonsentsjane – obamas vision
kommonsentsjane – obamas war
kommonsentsjane – obamas wolves
kommonsentsjane – obamas word
kommonsentsjane – obamas/dans red meat speeches
kommonsentsjane – obama, democratic party, raping america
kommonsentsjane – obama, the constitution, and the bible
kommonsentsjane – obamacare
kommonsentsjane – obamacare – a pig in a poke
kommonsentsjane – obamacare 101-1
kommonsentsjane – obamacare 101-4
kommonsentsjane – obamacare and doctors
kommonsentsjane – obamacare and guns
kommonsentsjane – obamacare architecht gruber
kommonsentsjane – obamacare audit goes unreported by main st media
kommonsentsjane – obamacare co-ops
kommonsentsjane – obamacare nevada
kommonsentsjane – obamacare repeal bill
kommonsentsjane – obamacare taxes due 4/15
kommonsentsjane – obamas net worth
kommonsentsjane – obamer
kommonsentsjane – obituary
kommonsentsjane – office down page
kommonsentsjane – officer brian moore
kommonsentsjane – oil and water
kommonsentsjane – okla terrorist
kommonsentsjane – oklahoma
kommonsentsjane – oklahoma hoodie bill
kommonsentsjane – oliver north vs al gore
kommonsentsjane – omnibus spending bill
kommonsentsjane – on-line voting
kommonsentsjane – one beautiful body
kommonsentsjane – one in and one out
kommonsentsjane – one pic explains why they want gun control
kommonsentsjane – only in america 2
kommonsentsjane – only the brain dead vote for trump
kommonsentsjane – oops! Poor timing
kommonsentsjane – open borders only one way
kommonsentsjane – open lettr to trump
kommonsentsjane – operation choke point
kommonsentsjane – opertion fast and furious scheme
kommonsentsjane – oregon shooter
kommonsentsjane – oregon shooting
kommonsentsjane – oregon shootings
kommonsentsjane – oreo cookies going south
kommonsentsjane – oscars boycott
kommonsentsjane – osu professor mia
kommonsentsjane – our democrat
kommonsentsjane – our government advisories
kommonsentsjane – our lost constitution
kommonsentsjane – our parents
kommonsentsjane – out with the old dried up politicians
kommonsentsjane – out with the old, in with the new
kommonsentsjane – outstanding high school
kommonsentsjane – overloading the labor market
kommonsentsjane – paid protestors
kommonsentsjane – pakistani children
kommonsentsjane – palestine
kommonsentsjane – palestine instigating terrorism
kommonsentsjane – palestine wants democratic elections too
kommonsentsjane – palestinian-israeli attacks
kommonsentsjane – palestinians
kommonsentsjane – palestinians/abbas try to scare the world
kommonsentsjane – panettas benghazi
kommonsentsjane – parents
kommonsentsjane – parents and children
kommonsentsjane – paris attacker
kommonsentsjane – paris attacks
kommonsentsjane – paris francememorial
kommonsentsjane – partisan news media so he says
kommonsentsjane – pass the salt
kommonsentsjane – pastor speaks
kommonsentsjane – pat caddell
kommonsentsjane – pataki
kommonsentsjane – pathetic debate
kommonsentsjane – patriot act debate
kommonsentsjane – paul harvey
kommonsentsjane – paul harveys predictions
kommonsentsjane – paul ryan votes with obama
kommonsentsjane – pay raise for our troops
kommonsentsjane – peace
kommonsentsjane – peace and happiness
kommonsentsjane – pearsons video on the presidents love of country
kommonsentsjane – pelosi
kommonsentsjane – pelosi loses her kool on immigration
kommonsentsjane – pelosis wrath
kommonsentsjane – pensions
kommonsentsjane – pentagon and undocumented enlistment policy
kommonsentsjane – people and a word
kommonsentsjane – people and guns
kommonsentsjane – people calling for bill clintons arrest for parading around ma election places
kommonsentsjane – people on welfare
kommonsentsjane – pepsi canned drink
kommonsentsjane – persecution of christians
kommonsentsjane – personal assassinations
kommonsentsjane – petition
kommonsentsjane – petraeus
kommonsentsjane – petrobras u.S. Loan
kommonsentsjane – pilots for 9/11 truth
kommonsentsjane – pistol packin mamas
kommonsentsjane – plan for america
kommonsentsjane – planned parent hood
kommonsentsjane – planned parenthood
kommonsentsjane – plans for isis?
kommonsentsjane – please vote on march 1, tuesday
kommonsentsjane – pm cameron
kommonsentsjane – pm hollande
kommonsentsjane – pm netanyahu re-elected
kommonsentsjane – police
kommonsentsjane – police departments
kommonsentsjane – policeman brian moore
kommonsentsjane – policy riders
kommonsentsjane – politcal correctness
kommonsentsjane – political cartoonist
kommonsentsjane – political correctness
kommonsentsjane – political correctness on a rampage
kommonsentsjane – political correctness rampage
kommonsentsjane – political insiders
kommonsentsjane – politically correct police chief
kommonsentsjane – politicans and the world
kommonsentsjane – politicians
kommonsentsjane – politicians and community organizers
kommonsentsjane – politics
kommonsentsjane – politics as usual – cruz and rubio
kommonsentsjane – politifact
kommonsentsjane – poll numbers
kommonsentsjane – poll numbers and obama
kommonsentsjane – polling liars
kommonsentsjane – polls and polling information
kommonsentsjane – polls and the passing of bills
kommonsentsjane – pope and climate change
kommonsentsjane – pope francis
kommonsentsjane – pope francis – show respect and distance
kommonsentsjane – pope francis unaired interview
kommonsentsjane – pope francis visit
kommonsentsjane – pope visit to mexico
kommonsentsjane – posse comitatus act
kommonsentsjane – posse comitatus line
kommonsentsjane – potential strategy of summit
kommonsentsjane – potty-trained isis
kommonsentsjane – potus auditioning for his next job
kommonsentsjane – potus speech
kommonsentsjane – poverty
kommonsentsjane – prayer
kommonsentsjane – president dead wrong
kommonsentsjane – president trump vows to place 100% tariff on countries not doing business on the us dollar.
kommonsentsjane – presidential campaign
kommonsentsjane – presidential debate
kommonsentsjane – prez of us is not king
kommonsentsjane – prez illegal executive amnesty
kommonsentsjane – price gouging
kommonsentsjane – prime minister cameron
kommonsentsjane – prime minister netanyahu
kommonsentsjane – prime minister netanyahu address
kommonsentsjane – privileged in america
kommonsentsjane – privileged white folks
kommonsentsjane – problem is obama
kommonsentsjane – professor carol swain
kommonsentsjane – professor nick bromell
kommonsentsjane – professor spews hate
kommonsentsjane – profile of ted cruz
kommonsentsjane – progressives throw money at problems, conservatives solve the problem
kommonsentsjane – project 2025 lies make it to hershey before the truth can get its pants on.
kommonsentsjane – project america run
kommonsentsjane – proposition 6
kommonsentsjane – protect america vote
kommonsentsjane – protecting america
kommonsentsjane – protestors
kommonsentsjane – protestors and marches
kommonsentsjane – public defender
kommonsentsjane – public embarrassment
kommonsentsjane – public service in texas
kommonsentsjane – public vs private persona according to the media
kommonsentsjane – puerto rico left wing downfall
kommonsentsjane – punishment
kommonsentsjane – pureto rico left wing downfall
kommonsentsjane – purses for spring
kommonsentsjane – putin
kommonsentsjane – putin and the ukraine
kommonsentsjane – putin in china
kommonsentsjane – putin on muslims
kommonsentsjane – putins american thorn in his side
kommonsentsjane – putins visit to bushs texas ranch
kommonsentsjane – putting my foot down
kommonsentsjane – queen hillary
kommonsentsjane – queen of the netherlands
kommonsentsjane – quentin tarantino
kommonsentsjane – quinnipiac poll
kommonsentsjane – race
kommonsentsjane – race and the leader
kommonsentsjane – racism
kommonsentsjane – racism and history
kommonsentsjane – racism its not
kommonsentsjane – radical islam
kommonsentsjane – radical islamic threat
kommonsentsjane – ragging republican candidates
kommonsentsjane – rainwater rights
kommonsentsjane – raising children
kommonsentsjane – raising the minimum wage
kommonsentsjane – ramadi abandoned
kommonsentsjane – ramos and liu
kommonsentsjane – ramos jorge
kommonsentsjane – rand paul
kommonsentsjane – rape crimes covered up
kommonsentsjane – rattlesnake logic
kommonsentsjane – ray lewis
kommonsentsjane – reagans capitalism
kommonsentsjane – reagans warning
kommonsentsjane – real money
kommonsentsjane – recall the election
kommonsentsjane – red state papa-loser
kommonsentsjane – reform muslims
kommonsentsjane – refugee crisis
kommonsentsjane – refugees coming not vetted
kommonsentsjane – reid states, rubio doesnt stand for anything
kommonsentsjane – reids pac
kommonsentsjane – reince priebus
kommonsentsjane – relax and have some fun with oktoberfest
kommonsentsjane – religion
kommonsentsjane – religion vs politics
kommonsentsjane – religious freedom
kommonsentsjane – religious freedom in the military
kommonsentsjane – religious liberties must be protected
kommonsentsjane – religious liberty
kommonsentsjane – rep joe wilson
kommonsentsjane – rep michael mccaul
kommonsentsjane – repeal the cash cow called obamacare
kommonsentsjane – republican 2016 debate highlights
kommonsentsjane – republican debate
kommonsentsjane – republican debate issues
kommonsentsjane – republican debate moderators
kommonsentsjane – republican desperation and their yes man
kommonsentsjane – republican party
kommonsentsjane – republican pledge
kommonsentsjane – republican voters
kommonsentsjane – republicans
kommonsentsjane – republicans caving in
kommonsentsjane – republicans voting with democrats
kommonsentsjane – republicans want to prove they can lead
kommonsentsjane – respect
kommonsentsjane – retire harry reid
kommonsentsjane – retirement funds
kommonsentsjane – rev graham message to candidates
kommonsentsjane – reverend billy graham
kommonsentsjane – rhinos in the debate
kommonsentsjane – rich lowry
kommonsentsjane – rich lowrys national review
kommonsentsjane – richard pryor 32 years ago
kommonsentsjane – riding ahead of the herd
kommonsentsjane – rino gutter talk
kommonsentsjane – ritualistic rally in iran
kommonsentsjane – rocket scientists at work
kommonsentsjane – roman empire vs super bowl
kommonsentsjane – romney and ryan are not conservatives
kommonsentsjane – romney light
kommonsentsjane – romney using reids age-old logic – did you beat your wife for the last ten years
kommonsentsjane – romney working for a brokered convention
kommonsentsjane – romneys soiree
kommonsentsjane – rons take
kommonsentsjane – routh & disabilty
kommonsentsjane – rouths path
kommonsentsjane – roy orbison documentary
kommonsentsjane – rubio and miami foam parties
kommonsentsjane – rubio and the american economy
kommonsentsjane – rubio betrayed american people
kommonsentsjane – rubio vs trump
kommonsentsjane – rubios broken promise – amnesty
kommonsentsjane – rules for radicals
kommonsentsjane – rumor – holder and supreme court
kommonsentsjane – rupert murdoch
kommonsentsjane – rush limbaughs push to stop trump
kommonsentsjane – russell brand receives an award
kommonsentsjane – russia
kommonsentsjane – russia and the usa
kommonsentsjane – russia burns soros donated books
kommonsentsjane – russias human rights
kommonsentsjane – ryans bill for illegals passed and signed by the muslim leader
kommonsentsjane – s&l scandal
kommonsentsjane – samsungs leo burnett idea
kommonsentsjane – san antonio football team
kommonsentsjane – san bernardino party
kommonsentsjane – san bernardino shooting
kommonsentsjane – san bernardno victim tribute
kommonsentsjane – sanctuary cities
kommonsentsjane – sanctuary cities act
kommonsentsjane – sanctuary city bills
kommonsentsjane – sanctuary city vote
kommonsentsjane – sand is now oil
kommonsentsjane – sanders and clinton deceiving the america people
kommonsentsjane – sanders to dearborn muslims: israels existence to blame for mideast hatred and warfare
kommonsentsjane – sanders wants 90% of our money
kommonsentsjane – sandy hook
kommonsentsjane – sarah palin
kommonsentsjane – sarah palin at cpac
kommonsentsjane – sarandon and religious freedom
kommonsentsjane – saudi arabia
kommonsentsjane – saudi arabia executes 47
kommonsentsjane – saudi arabia extortion of america
kommonsentsjane – saudi arabia take no refugees
kommonsentsjane – saudi gifts to obama
kommonsentsjane – saudi prince mouthing
kommonsentsjane – saudi women
kommonsentsjane – saudia arabia
kommonsentsjane – saul alinsky
kommonsentsjane – scalia autopsy decision divides pathologists
kommonsentsjane – scalias death
kommonsentsjane – scalias visit to west texas ranch
kommonsentsjane – scary obituary
kommonsentsjane – school lunch program
kommonsentsjane – school officials
kommonsentsjane – schools and islam
kommonsentsjane – scripted rubio flip side off obama coin
kommonsentsjane – second amendment
kommonsentsjane – secret iran agreement
kommonsentsjane – secret society afraid of trump
kommonsentsjane – section 603s reporting
kommonsentsjane – selective outrage
kommonsentsjane – selfie posting sticks
kommonsentsjane – senate and congress
kommonsentsjane – senate still has power to stop obama
kommonsentsjane – senator and obama
kommonsentsjane – senator diana feinstein
kommonsentsjane – senator diane feinstein
kommonsentsjane – senator sessions pickle
kommonsentsjane – senseless killing by a muslim
kommonsentsjane – sexual abuse is a crime – religion or no religion
kommonsentsjane – sgt major pendry
kommonsentsjane – shadow curriculum
kommonsentsjane – shakespeares undoing
kommonsentsjane – sharia law
kommonsentsjane – sharia law in texas
kommonsentsjane – sharpton and the constitution
kommonsentsjane – sharpton and the prez
kommonsentsjane – sharptons new job
kommonsentsjane – sheen tweets on obama
kommonsentsjane – shift happens
kommonsentsjane – silent night and light show
kommonsentsjane – simpler tax plan
kommonsentsjane – sin city
kommonsentsjane – sisters
kommonsentsjane – skeltons in the closet
kommonsentsjane – slavery
kommonsentsjane – sleeping habits
kommonsentsjane – slime award
kommonsentsjane – smothering small businesses
kommonsentsjane – snow and global warming
kommonsentsjane – soccer corruption
kommonsentsjane – social media
kommonsentsjane – social security
kommonsentsjane – social security and medicare
kommonsentsjane – social security disability sob story
kommonsentsjane – socialism
kommonsentsjane – socialism in greece
kommonsentsjane – socialist media whining
kommonsentsjane – soldier discharged protecting a child in afghan
kommonsentsjane – soldiers story of war
kommonsentsjane – somalis in minnesota
kommonsentsjane – some class is needed
kommonsentsjane – some women and even black women will not vote for hillary
kommonsentsjane – song of the week – 14
kommonsentsjane – song of the week – 25
kommonsentsjane – song of the week – 27
kommonsentsjane – song of the week – 30
kommonsentsjane – song of the week – 48
kommonsentsjane – song of the week – 53
kommonsentsjane – song of the week – 55
kommonsentsjane – song of the week – 56
kommonsentsjane – song of the week – 57
kommonsentsjane – song of the week – 59
kommonsentsjane – song of the week – 61
kommonsentsjane – song of the week 28
kommonsentsjane – soros
kommonsentsjane – soros invests in fire arms
kommonsentsjane – soros black lives matter project
kommonsentsjane – soros/obamas hired help disrupt trump rally
kommonsentsjane – speaker of the house
kommonsentsjane – speaker of the house grades
kommonsentsjane – spirtual orbs
kommonsentsjane – spring break
kommonsentsjane – spurs
kommonsentsjane – stabenow – congress woman
kommonsentsjane – state dept and hillary
kommonsentsjane – state of the union speech
kommonsentsjane – states trimming the fat
kommonsentsjane – states rights
kommonsentsjane – statue of liberty and swearing in
kommonsentsjane – steins christmas tree story
kommonsentsjane – stephanopoulos
kommonsentsjane – sterns conversation with m. Kelly
kommonsentsjane – steve harvey gaffe
kommonsentsjane – steve hayes
kommonsentsjane – steve jobs
kommonsentsjane – steve jobs message
kommonsentsjane – stiletto shoes
kommonsentsjane – stock market
kommonsentsjane – stop and get off
kommonsentsjane – stop obama admin lawlessness
kommonsentsjane – strange happenings
kommonsentsjane – strengths and weaknesses
kommonsentsjane – stress
kommonsentsjane – stress and life
kommonsentsjane – struggling to print
kommonsentsjane – stuck in the mud
kommonsentsjane – stump for trump girls
kommonsentsjane – sugar scientists
kommonsentsjane – suicide bomber
kommonsentsjane – sunlight and cartoons
kommonsentsjane – sunshine is the disinfectant in life
kommonsentsjane – super bowl
kommonsentsjane – supreme court
kommonsentsjane – supreme court and gosnells abortion house of horrors
kommonsentsjane – supreme court roberts
kommonsentsjane – supreme court ruling on energy
kommonsentsjane – supreme court rulings coming
kommonsentsjane – supreme court will hear obamas illegal immigration over reach
kommonsentsjane – survey usa
kommonsentsjane – swat raids
kommonsentsjane – sweden
kommonsentsjane – switching parties
kommonsentsjane – synopsis of the election and the candidates
kommonsentsjane – syria
kommonsentsjane – syria air strikes
kommonsentsjane – syrias chips
kommonsentsjane – syrias setback
kommonsentsjane – syrian immigrants
kommonsentsjane – syrian immigration program
kommonsentsjane – syrian refugees
kommonsentsjane – syrian refugees bill
kommonsentsjane – syrian refugees vote
kommonsentsjane – syrian war
kommonsentsjane – twas the day after the elections
kommonsentsjane – take microsoft out of the equation
kommonsentsjane – taking care of our vets first
kommonsentsjane – taking our country back
kommonsentsjane – taming the wild
kommonsentsjane – target
kommonsentsjane – taxes and more taxes
kommonsentsjane – taxpayer-funded housing
kommonsentsjane – taylor swift
kommonsentsjane – teachers code of ethics
kommonsentsjane – tech workers in usa
kommonsentsjane – technology
kommonsentsjane – ted cruz
kommonsentsjane – ted cruz eats a booger at the debate
kommonsentsjane – ted cruz fabricating non-truths
kommonsentsjane – ted cruz gun petition
kommonsentsjane – ted cruz joins bill ayers
kommonsentsjane – ted cruz should be so lucky
kommonsentsjane – ted cruz statement
kommonsentsjane – ted cruzs dirty tricks have to stop
kommonsentsjane – ted cruzs wife goldman sachs vp
kommonsentsjane – ten commandments
kommonsentsjane – terrorism
kommonsentsjane – terrorism and the airlines
kommonsentsjane – terrorism in usa
kommonsentsjane – terrorism light
kommonsentsjane – terrorists
kommonsentsjane – terrorists and their families
kommonsentsjane – terrorists kill caretaker nuns and elderly
kommonsentsjane – terrorists money laundering
kommonsentsjane – tesla batteries
kommonsentsjane – texas and obamas gun grab
kommonsentsjane – texas girls
kommonsentsjane – texas pastors for trump
kommonsentsjane – texting
kommonsentsjane – thank you, taylor swift
kommonsentsjane – thanks
kommonsentsjane – thanksgiving and gratitude
kommonsentsjane – the 28th amendment
kommonsentsjane – the 9/11 background
kommonsentsjane – the 9/11 cross
kommonsentsjane – the 9/11 shirt
kommonsentsjane – the academy awards in reverse
kommonsentsjane – the american dream
kommonsentsjane – the american flag
kommonsentsjane – the american indian
kommonsentsjane – the american people have been burned badly by this government
kommonsentsjane – the animal world
kommonsentsjane – the armenian genocide and why it matters
kommonsentsjane – the art of saddle making
kommonsentsjane – the atheists comfort zone
kommonsentsjane – the battle with cancer
kommonsentsjane – the bells toll
kommonsentsjane – the benghazi poem
kommonsentsjane – the big immigration lie
kommonsentsjane – the big payoff
kommonsentsjane – the birds of paradise project
kommonsentsjane – the birth of baby jesus phenomenon
kommonsentsjane – the brit is back
kommonsentsjane – the budget and obamacare
kommonsentsjane – the buffalo soldiers
kommonsentsjane – the bundy ranch fight for their land
kommonsentsjane – the canary
kommonsentsjane – the changing christmas
kommonsentsjane – the chicken question
kommonsentsjane – the chinese yuan
kommonsentsjane – the christmas spirit
kommonsentsjane – the clinton and obama duo
kommonsentsjane – the clinton foundation
kommonsentsjane – the clinton slush fund
kommonsentsjane – the clintons
kommonsentsjane – the clock and ahmed
kommonsentsjane – the clown
kommonsentsjane – the coach and the truth
kommonsentsjane – the coalition and isis
kommonsentsjane – the competition
kommonsentsjane – the consortium
kommonsentsjane – the constitution
kommonsentsjane – the corrupted political system
kommonsentsjane – the court system
kommonsentsjane – the crazy uncle
kommonsentsjane – the cynical humbug
kommonsentsjane – the dark side
kommonsentsjane – the deal with iran
kommonsentsjane – the death penalty
kommonsentsjane – the debate
kommonsentsjane – the debt
kommonsentsjane – the debt limit
kommonsentsjane – the debt limit fight
kommonsentsjane – the democrat
kommonsentsjane – the democrat and elite republicans are pooped
kommonsentsjane – the democrat communism sows ear
kommonsentsjane – the democrat idiots list
kommonsentsjane – the democrat thieves
kommonsentsjane – the democratic party
kommonsentsjane – the democrats newest squawk box.
kommonsentsjane – the dems and the elites
kommonsentsjane – the difference between men and women
kommonsentsjane – the discussion the media wont have
kommonsentsjane – the donald and jorge ramos
kommonsentsjane – the draw down of military
kommonsentsjane – the east catholic high school a cappella choir
kommonsentsjane – the economy myth
kommonsentsjane – the element of masochism whether it is iraq or ferguson
kommonsentsjane – the elephant test
kommonsentsjane – the elite republicans
kommonsentsjane – the employable americans
kommonsentsjane – the enemy within
kommonsentsjane – the environment
kommonsentsjane – the epa
kommonsentsjane – the europeans and the iranian deal
kommonsentsjane – the fake pollster prophets
kommonsentsjane – the fat cats budget
kommonsentsjane – the federal reserve
kommonsentsjane – the ferguson black panther story
kommonsentsjane – the first head of cerberus
kommonsentsjane – the first repub debate
kommonsentsjane – the flag scene
kommonsentsjane – the found gold train
kommonsentsjane – the fourth reich
kommonsentsjane – the fox trot
kommonsentsjane – the gaza strip
kommonsentsjane – the glaziev directive
kommonsentsjane – the golden rule in life
kommonsentsjane – the gop
kommonsentsjane – the green side of the grass
kommonsentsjane – the hair piece
kommonsentsjane – the haves and have nots
kommonsentsjane – the history of is
kommonsentsjane – the history of isis
kommonsentsjane – the holy war
kommonsentsjane – the imf
kommonsentsjane – the immigration act
kommonsentsjane – the income fraud
kommonsentsjane – the income gap
kommonsentsjane – the inconvenient facts the media ignore about climate change
kommonsentsjane – the iran deal
kommonsentsjane – the iran heist
kommonsentsjane – the iraq war
kommonsentsjane – the isis mad dogs
kommonsentsjane – the isis threat
kommonsentsjane – the islamization of france
kommonsentsjane – the key to confronting radicalization
kommonsentsjane – the knots prayer
kommonsentsjane – the koch brothers
kommonsentsjane – the lawless
kommonsentsjane – the leader and ceos social responsibility
kommonsentsjane – the leaders ego
kommonsentsjane – the left and marriage
kommonsentsjane – the loss of a pet
kommonsentsjane – the low down steaks
kommonsentsjane – the main reason for the season
kommonsentsjane – the messiah
kommonsentsjane – the middle class
kommonsentsjane – the middle class crash
kommonsentsjane – the middle east wars
kommonsentsjane – the military problem
kommonsentsjane – the miss universe contest
kommonsentsjane – the muslim attacker in tn
kommonsentsjane – the muslim religion
kommonsentsjane – the muslim/democratic debate
kommonsentsjane – the mystery
kommonsentsjane – the national debt
kommonsentsjane – the national review sucks
kommonsentsjane – the natives are getting restless world wide – they are afraid of trump
kommonsentsjane – the next leader
kommonsentsjane – the no fly list
kommonsentsjane – the obama game
kommonsentsjane – the obama jackal
kommonsentsjane – the obama list
kommonsentsjane – the obama paris fling on climate change
kommonsentsjane – the obamaphone fraud
kommonsentsjane – the oil money
kommonsentsjane – the patient one
kommonsentsjane – the patriot act
kommonsentsjane – the pentagon
kommonsentsjane – the people are the militia
kommonsentsjane – the perfect day
kommonsentsjane – the pledge of allegiance
kommonsentsjane – the pollyanna world
kommonsentsjane – the pope
kommonsentsjane – the pope and climate change
kommonsentsjane – the pope and obama
kommonsentsjane – the present is wake up – the past in chains is woke up.
kommonsentsjane – the presidency
kommonsentsjane – the prez advisor
kommonsentsjane – the prince of gaffes
kommonsentsjane – the prince of saudi arabia
kommonsentsjane – the prison camp violin
kommonsentsjane – the racist symbol
kommonsentsjane – the real bernie sanders
kommonsentsjane – the real reason oil is so cheap
kommonsentsjane – the real truth
kommonsentsjane – the real war on women
kommonsentsjane – the republican debate
kommonsentsjane – the rest of the story
kommonsentsjane – the right tweet
kommonsentsjane – the rise of intolerant liberals
kommonsentsjane – the road test
kommonsentsjane – the rules of life
kommonsentsjane – the sandy hook exploitation
kommonsentsjane – the saudi prince
kommonsentsjane – the shocking truth about the marxists behind the black lives matter organization: no forgiveness, no reconciliation
kommonsentsjane – the show down
kommonsentsjane – the slaughtering of christians in the world
kommonsentsjane – the socialist democrats who tried to ruin christmas in america
kommonsentsjane – the spiritual battle
kommonsentsjane – the stock market
kommonsentsjane – the supreme court |
| ( Read More... | 208784 bytes more | comments? | ) |
| |
| Dietary intake adequacy among Iranian older adults: evidence from national house |
| Posted on Friday, June 26 @ 00:02:41 PDT (7 reads) | |
|
|
Abstract
introduction:
iran’s aging population faces significant nutritional challenges. Comprehensive data on the dietary adequacy of older adults (oas) using multiple sources are limited. This study assessed the adequacy of energy, macro- and micronutrient intake among iranian oas using data from the national household survey and two population-based cohorts.
methods:
to comprehensively assess dietary intake patterns and nutrient adequacy among iranian oas, a multi-source analysis was conducted using: (1) the iranian household expenditure and income survey (iheis, 2019–2022, n = 110,765 oas) to estimate population-level intake via the older adult male equivalent (oame) method; and (2) individual-level data from two cohorts, the tehran lipid and glucose study (tlgs, n = 1,839) and the birjand longitudinal aging study (blas, n = 1,325). Nutrient adequacy ratios (nar) and mean adequacy ratios (mar) were calculated. Due to methodological differences, the datasets were analyzed separately, and the findings were interpreted in a complementary manner.
results:
iheis estimates revealed low intakes of fruits, vegetables, dairy, and meat, alongside a grain-dominant dietary pattern. Mean energy intake was below recommended levels and declined with age. Severe and persistent inadequacy was observed in the intake of several micronutrients, particularly vitamin d (nar ? 0.04), vitamin a (nar < 0.25), calcium (nar 0.22–0.35), zinc (nar 0.25–0.39), folate, and vitamin b12. Mar values ranged from 0.51 to 0.61, indicating that only about half of cumulative nutrient requirements were met, with consistently lower adequacy among women. Cohort data showed higher mean energy and nutrient intakes than those in iheis; however, substantial inter-individual variability was evident, and inadequacies in calcium, vitamin d, folate, and vitamin b12 persisted across cohorts.
discussion:
the diet of iranian oas is characterized by low dietary diversity, a high reliance on grains, and critical inadequacies in multiple micronutrients, with notable disparities by sex and age. Integrating adequacy-based indicators with multiple data sources provides a more accurate assessment of dietary vulnerability in older populations. The convergence of findings from household and individual-level data underscores an urgent need for targeted nutritional interventions to support healthy aging in iran.
1 introduction
population aging is set to be one of the greatest transformations of the twenty-first century, with far-reaching implications for all sectors of society. It is estimated that by 2050, one in five people will be aged 60 or older (1). While most will be in good health, this population will be confronted with the potential effects of the aging process, which can result in decreased quality of life, illness, or chronic diseases (2). Research over the past few decades has consistently demonstrated that adequate nutritional status can play a key role in preventing or delaying the progression of age-related diseases, including cardiovascular diseases (cvds), reduced cognitive function, and osteoporosis (3). Nutrition not only supports physical health but also influences psychological well-being, functional independence, and longevity, making it a cornerstone of healthy aging strategies (4).
however, physiological and social changes, such as decreased food intake, impaired sensory perception, malabsorption, reduced activity, and increased disability, can heighten the risk of inadequate nutritional status in this population (5). These challenges are often accompanied by socioeconomic inequalities, limited access to nutrient-dense foods, and cultural dietary patterns, all of which increase vulnerability to malnutrition (6). As a result of these changes, the recommended values for some nutrients are modified in the older adults (oas), with higher requirements for protein, calcium, vitamin d, b12, and certain antioxidants to compensate for age-related metabolic decline and bone loss (7).
the elderly population faces significant nutritional challenges, including both undernutrition and overnutrition. A study in iran found that the prevalence of malnutrition among the elderly was almost 12% across socioeconomic groups (8). Since low energy intake is often difficult to diagnose, elderly individuals are at a higher risk of weight loss, nutritional deterioration, morbidity, and mortality. Conversely, obesity also presents a major health risk; a systematic review highlighted an obesity prevalence of 21.4% among adults aged over 60 years, underscoring their vulnerability to chronic diseases such as cardiovascular disease (9). Beyond excessive caloric intake, micronutrient deficiencies pose another critical challenge to the health and well-being of the aged population.
given the global trend of population aging and the broad implications of inadequate dietary intake among this group in iran, there is a pressing need for comprehensive, well-designed studies to assess dietary adequacy relative to the requirements recommended for oas. Accurate evaluation of nutrient intake, comparison with dietary reference intakes, and identification of influencing factors can provide valuable insights for designing preventive programs and informing policy decisions at national and regional levels.
despite growing concern about nutritional inadequacy among iranian oas, existing evidence remains fragmented and methodologically limited. Most studies have focused either on the general adult population or on average dietary intakes, without assessing adequacy relative to age-specific requirements. Moreover, the potential discrepancies between household-based dietary estimates and individual-level intake data have not been systematically examined in this age group in iran. Accordingly, the present study aims to evaluate the nutritional adequacy of dietary intake among oas using data from the national household expenditure and income survey and two population-based cohorts. Addressing these gaps is essential to generating evidence that can effectively inform nutrition policy and aging-related interventions.
2 materials and methods
2.1 study design and data sources overview
this study is a secondary, descriptive-comparative analysis of nationally representative household data and two population-based cohort studies. The present study employed a multi-source comparative approach to describe dietary intake and nutrient adequacy among iranian oas. Given the absence of a single national dataset that provides both detailed individual dietary intake and nationally representative consumption data, two complementary sources were analyzed in parallel.
first, data from the iranian national household expenditure and income survey (iheis), a nationally representative household-based survey, were used as a proxy of usual intake at the population level to estimate average dietary and nutrient intakes of oas. Household-level food acquisition data were converted to individual-equivalent intakes using the older adult male equivalent (oame) approach, enabling estimation of population-level mean intakes rather than precise individual consumption estimates.
second, individual-level dietary intake and nutrient adequacy were assessed using two population-based cohort studies, the tehran lipid and glucose study (tlgs) and the birjand longitudinal aging study (blas), which provide detailed and direct measurements of individual food and nutrient intake. Due to fundamental differences in data structure and the level of dietary assessment (household-based versus individual-based), the datasets were analyzed separately and not pooled. Findings from each source are presented side by side and interpreted in a complementary manner to provide a coherent picture of average intake patterns and individual-level nutrient adequacy among oas in iran.
2.2 analysis 1: estimation of dietary intake from household expenditure data (iheis)
the iheis is an annual survey carried out by the statistical center of iran (sci). It employs a stratified, three-stage, clustered sampling design to select participants residing in both urban and rural areas nationwide. To obtain more accurate estimates, the samples were equally distributed across all months of the year between 2019 and 2022 and the total sample size of oas (>60 years) reached 110,765. This study used data from iheis, which provides an integrated overview of household structure and economic behavior. The dataset encompasses four principal domains; (1) demographic and social characteristics of household members, including the number of members and detailed demographic information such as age, sex, educational attainment, employment status, and marital status; (2) housing and living conditions, covering characteristics of the residence and availability of domestic facilities; (3) patterns of consumption and expenditure, encompassing both food and non-food expenditures as indicators of resource allocation across different sectors; (4) income composition, detailed information on earnings from wages, self-employment, and other income sources.
2.2.1 food data
since the food consumption data were collected at the household level, they were converted into individual-level dietary intakes. To avoid bias in the per capita estimates, the oame was calculated to account for differences in energy requirements among household members (10). Oame is defined as the ratio of each household member’s estimated energy requirement to that of a reference male aged 60 years or older, both with moderate physical activity. Both the reference value and household members’ energy requirements were derived in accordance with recommendations from the food and agriculture organization (fao) and the world health organization (who) (11, 12).
unlike crude per capita estimates, this approach allows the identification of each household member’s contribution to household food expenditure. Using this method, the total oame for each household was calculated by summing the oame values of all household members, accounting for their age and sex. Therefore, each person’s share of the household’s total oame was calculated by dividing each person’s oame by the household’s total oame and multiplying by the quantity of each food item, after separating people aged 60 and older.
given that a portion of purchased foods is typically wasted, the actual consumption quantities were adjusted using fao estimates of food loss percentages for each food group at the consumption stage within the “supply-to-consumption” chain (13). Following this adjustment, cooking yield factors were applied to food items that underwent processing or heat exposure, using iran-specific values (14). The energy, macronutrient, and micronutrient contents of foods were subsequently calculated using nutritionist iv software, which was updated for iranian foods.
2.2.2 dietary adequacy
to assess the adequacy of nutrient intake among men and women, the daily intakes of individual nutrients were compared with age-and sex-specific recommendations from who/fao (2004). Then, the nutrient adequacy ratio (nar) index was defined according to the guidelines of the inndex protocol (2018), by dividing the actual intake of each nutrient by its corresponding recommended intake:
mean adequacy index (mar) was then computed as an overall indicator of dietary adequacy, using nar values of 18 macro- and micronutrients, including energy, protein, carbohydrate, linoleic acid, linolenic acid, vitamin a, vitamin c, thiamine, riboflavin, niacin, pyridoxine, folic acid, cobalamin, vitamin d, iron, zinc, calcium, and phosphorus. Each nar value was truncated at 1 to prevent compensation for inadequacy in one nutrient by excessive intake of another. Subsequently, mar was derived by averaging all nar values.
2.3 analysis 2: nutrient intake from cohort studies (tlgs and blas)
2.3.1 cohorts descriptions and participants
this study also utilized secondary data from two independent population-based cohort studies conducted in iran: tehran lipid and glucose study (tlgs) and birjand longitudinal aging study (blas). Both datasets were used to assess individual-level dietary intake and nutrient adequacy among oas aged 60 years and older. From the tlgs dataset, individual-level dietary information of 1,839 oas residing in tehran was extracted and included in the analysis. For the blas cohort, data representing 1,325 urban oas in birjand city, south khorasan, eastern iran, from the first wave of the cohort (october 2018 and april 2019)—including means and standard deviations of key variables—were provided by the respective research team. Participants in the blas cohort were recruited using a multistage, stratified, cluster-random sampling method targeting individuals aged 60 years and over.
2.3.2 dietary assessment and data processing
in both cohorts, habitual dietary intake was recorded using a validated food frequency questionnaire (ffq) developed specifically for the iranian population (15). This ffq included major food items consumed in iran and allowed estimation of daily energy, macronutrient, and micronutrient intakes. Dietary data were reported in both cohorts as mean daily intakes (g/day). For data preparation, individual-level data from the tlgs cohort were first screened for completeness. Records with more than 20% missing information on food items or nutrient values were excluded. Outliers were identified and removed based on the acceptable energy intake range (500–5,000 kcal per day) and values exceeding three standard deviations from the mean for major nutrients. For the blas cohort, since the data were provided only as summary statistics (means and standard deviations), individual-level data cleaning was not possible, and analyses were performed directly on the provided summary data. The blas summary data included the same set of parameters and were incorporated directly into the results tables. Due to methodological heterogeneity across studies, such as assessment tools and measurement levels (household or individual), datasets were not pooled. Therefore, the analysis was performed independently.
2.4 statistical analysis
for the iheis, all demographic calculations (oame factors, total household oame, individual shares) were performed using microsoft excel and r software. The primary output was a dataset in which each oa (?60 years) had an estimated daily quantity (in grams) of each food item, adjusted for waste and cooking yield, as described in sections 2.2.2 and 2.2.3. Monthly purchase quantities were converted to daily values by dividing by 30.5, reflecting the average length of a month in the iranian calendar (in which six months have 30 days and six have 31). Descriptive statistics (mean, standard deviation, and 95% confidence interval) for daily per-older-adult food quantities were calculated overall and stratified by age groups (60–74, 75–84, and ?85 years) and sex. For the tlgs cohort, all analyses (descriptive statistics and mean nutrient intakes) were performed on the cleaned individual-level data using spss (version 26). For the blas cohort, analyses were based on the provided data. Direct comparisons of means to rdas were made using the provided mean intakes. Descriptive statistics (mean, standard deviation, and 95% confidence interval) for the daily per-older-adult food quantities were calculated overall and stratified by sex.
2.5 ethical considerations
both tlgs and blas protocols had previously been approved by the ethics committees of their respective institutions. All participants had completed written informed consent prior to enrollment. The iheis data used in the present study were secondary and contained no identifying information.
3 results
3.1 analysis 1: estimated daily dietary intake from household purchases (iheis)
3.1.1 food groups intake patterns
based on the iheis data (table 1), the estimated daily oa consumption for several key food groups was considerably low, with substantial variability indicated by large standard deviations. The mean (±sd) estimated consumption of fruits and vegetables was 58.1 ± 70.8 g/day and 93.1 ± 96.0 g/day, respectively; both below the recommendations. The standard deviation for fruits exceeding the mean suggests extreme variability across participants from households. The estimated dairy product intake was markedly low (64.1 ± 68.0 g/day). The near-equal magnitude of the mean and standard deviation underscores a highly unequal distribution. Similarly, the estimated intake of meat products averaged 55.6 ± 63.5 g/day, which does not meet the recommended dietary intake for oas. In contrast, the estimated grain consumption was high on average (347.6 ± 292.9 g/day) and exhibited substantial absolute variability. High grain intake indicates the dominant role of bread and the grain group in the dietary pattern of elderly iranians.
table 1
| food groups | individual-level dietary intake | household-level dietary intake | nutritional recommended values | ||||
|---|---|---|---|---|---|---|---|
| blas (n = 1,325) | tlgs (n = 1,839) | iheis (2019–2022) (n = 110,766) | |||||
| mean | sd | mean | sd | mean | sd | ||
| fruits (g) | 56.2 | 104.5 | 384.5 | 299.0 | 58.1 | 70.8 | 2 cups eq/day (210 g/day) (
|
30)30)30)30)mean daily intake of major food groups among iranian community-dwelling older adults compared with national household survey data, tehran lipid and glucose study (tlgs), birjand longitudinal aging study (blas), and dietary recommendations.
data sources include the birjand longitudinal aging study (blas), tehran lipid and glucose study (tlgs), and the iran national household expenditure and income survey (iheis; 2019–2022).
recommended intakes are expressed as cup equivalents (c-eq/day) or ounce equivalents (oz-eq/day) according to established dietary guidelines for older adults and converted to grams for comparison where applicable.
grain intake data were not available for blas.
the findings from individual and household-levels should be interpreted complementarily, due to their distinct methodological approaches.
3.1.2 energy, macro- and micronutrients intake
based on the iheis data (table 2), the mean (±sd) of estimated daily energy intake for oas was 1447.6 ± 1066.0 kcal, which is below the recommended levels for both men and women. This estimate showed substantial variability, as indicated by the large standard deviation. The contributions of proteins and fats to total energy were at the lower end of recommended ranges: carbohydrates provided 65%, proteins 12.6%, and total fats 24%. Notably, dietary fiber intake was critically low, with a mean (±sd) of 9.2 ± 7.2 g/day, far below the sex-specific recommendations of 21–30 g/day.
table 2
| energy & macronutrients | individual-level dietary intake | household-level dietary intake | nutritional recommended values | ||||
|---|---|---|---|---|---|---|---|
| blas (n = 1,325) | tlgs (n = 1,839) | 2019–2022 (n = 110,766) | |||||
| mean | sd | mean | sd | mean | sd | ||
| energy (kcal) | 2466.4 | 1535.1 | 1938.2 | 633.9 | 1447.6 | 1066.0 | men: 2,450 kcal/day‡ women: 2,000 kcal/day‡ (
|
| carbohydrate (g) (en%) | 356.7 (58) | 309.0 | 300.1 (62) | 106.0 | 234.2 (65) | 170.4 | 55–75 en% (
|
70)71)71)71)71)women: 21 g/day (
72)73)72)women: 8 mg/day (
72)72)women: 700 ?G/day (
72)women: 1.1 mg/day (
72)women: 1.1 mg/day (
72)women: 14 mg/day (
72)women: 1.5 mg/day (
72)72)72)73)women: 75 mg/day (
72)mean daily intake of energy, macro- and micronutrients among iranian community-dwelling older adults compared with national household survey data, tehran lipid and glucose study (tlgs), birjand longitudinal aging study (blas), and dietary reference values.
values are presented as mean ± standard deviation (sd).
energy contributions of macronutrients are expressed as percentage of total energy intake (en%) where applicable.
dietary reference values are based on established recommendations for older adults and are presented separately for men and women where applicable.
missing values indicate nutrients not available in the corresponding dataset.
the estimated intakes of most micronutrients from household food purchases were substantially below recommended levels, with evidence of high variability (large sds relative to means). Mean (±sd) for calcium intake was 353.0 ± 317.0 mg/day, less than one-third of the recommendation (1,200 mg/day). Zinc intake was similarly inadequate (3.6 ± 3.7 mg/day), whereas iron intake averaged 10.6 ± 8.4 mg/day, exceeding the recommended 8 mg/day. A severe deficiency was observed in fat-soluble vitamins. Vitamin d intake was negligible (0.4 ± 0.5 ?G/day), and vitamin a intake was 271.4 ± 375.0 ?G/day, both substantially below recommended levels. Among water-soluble vitamins, folate (b9) intake was low (171.3 ± 179.0 ?G/day), and vitamin b12 intake was estimated at 1.06 ± 2.3 ?G/day. Vitamin c intake was 31.3 ± 26.8 mg/day, which also fell below recommended intakes and showed marked variability across households.
3.1.3 age-related variation in energy and nutrient intake among oas
as illustrated in figure 1, analysis of the iheis data demonstrated a progressive decline in mean energy intake and in most nutrients with advancing age among oas. Mean daily energy intake decreased from 1,467 kcal (95% ci: 1459.8, 1474.2) in the 60–74 age group to 1,425 kcal (95% ci: 1410.1, 1439.9) in the 75–84 age group and further to 1,301 kcal (95% ci: 1277.7, 1324.3) in those aged over 85 years. A similar age-related downward trend was observed for dietary fiber intake. Mean fiber intake declined from 9.3 g (95% ci: 9.20, 9.40) in the youngest group to 9.1 g (95% ci: 8.90, 9.30) in those aged 75–84 years and to 8.2 g (95% ci: 7.88, 8.52) in the oldest group, which is far from the recommended values.
figure 1
calcium intake also showed a consistent decrease with age, declining from 357.5 mg (95% ci: 353.2, 361.8) to 349 mg (95% ci: 340.1, 357.9) and 316.5 mg (95% ci: 302.7, 330.3). These values are less than one-third of the recommended daily intake in all age groups. Zinc intake also decreased with age, from 3.6 mg (95% ci: 3.55, 3.65) to 3.5 mg (95% ci: 3.40, 3.60) and 3.1 mg (95% ci: 2.94, 3.26). Vitamin a intake was low across all three age groups and declined steadily. The mean intake of this vitamin declined from 277 ?G (95% ci: 271.7, 282.3) in the youngest group to 263 ?G (95% ci: 254.1, 271.9) and 231.7 ?G (95% ci: 217.6, 245.8) in the elderly aged 85 years and older. Folate (vitamin b9) intake also diminished with age, from 174.4 ?G (95% ci: 172.0, 176.8) in the 60–74 age group to 167.1 ?G (95% ci: 161.8, 172.4) and 152.4 ?G (95% ci: 144.8, 160.0) in people over 85 years. Overall, the simultaneous decrease in intake of energy, fiber, calcium, zinc, and key vitamins with advancing age highlights an increased risk of nutritional inadequacies in oas. Detailed estimates of nutrient intakes across age groups are presented in supplementary table 1.
3.1.4 sex-related differences in energy and nutrient intake among oas
as shown in figure 2, the iheis estimates revealed clear and significant sex-related differences in energy and nutrient intake among oas. Men had a higher mean daily energy intake (1,506 kcal, 95% ci: 1497.2, 1514.8) than women (1,406 kcal, 95% ci: 1397.0, 1415.0).
figure 2
this sex-based pattern was consistent across several key nutrients. Mean calcium intake was higher in men (305 mg/day; 95% ci: 302.4–307.6) compared to women (287 mg/day; 95% ci: 284.3–289.7), although intakes in both sexes remained well below recommended levels. Similarly, estimated zinc intake was 3.00 mg (95% ci: 2.97–3.03) per day for men and 2.75 mg (95% ci: 2.72–2.78) per day for women. Sex–related detailed nutrient intakes are provided in supplementary table 2.
for vitamin a, the estimated intake was below recommended levels for both sexes, with means of 173 ?G (95% ci: 169.6, 176.4) for men and 162 ?G (95% ci: 159.2, 164.8) for women. Folate intake followed a similar pattern, with men consuming a mean of 180 ?G/day (95% ci: 178.51, 181.49) and women 166 ?G/day (95% ci: 164.51, 167.49).
overall, these findings demonstrate persistent sex-related differences in energy and nutrient intake among iranian oas, with men consistently reporting higher intakes than women. However, the inadequacy of several micronutrients remained evident in both sexes, as indicated by household food purchase estimates.
3.1.5 nutrient adequacy
as shown in figure 3, the nar results revealed a widespread and persistent inadequacy of most micronutrients in the elderly between 2019 and 2022, with a relatively stable pattern over time and between sexes. A severe and uniform inadequacy was observed for fat-soluble vitamins. Vitamin a intake was consistently inadequate in both sexes and in all years, with nar values of 0.19 in men and between 0.23 and 0.24 in women, indicating that less than a quarter of the recommended intake was achieved. Vitamin d demonstrated the lowest adequacy among the micronutrients. In men, the nar declined from 0.03 in 2019 to 0.02 in 2020–2022, and in women it remained between 0.02 and 0.04, reflecting severe and persistent inadequacy of this vitamin throughout the study period.
figure 3
a concerning decline in the adequacy of key minerals was noted. Calcium adequacy was low and declined over time, with the nar decreasing from 0.35 in 2019 to 0.28 in 2022 in men and from 0.27 to 0.22 in women. Zinc intake was inadequate in both sexes, with nar values ranging from 0.25 to 0.31 in men and from 0.32 to 0.39 in women, and consistently higher in women than in men.
among b vitamins, vitamins b1 and b3 indicated relatively adequate intake. However, folate intake declined over time, with nar values decreasing from 0.64 in 2019 to 0.36 in 2022 in men and from 0.59 to 0.31 in women. In both sexes, the nar of vitamin b12 also remained below 0.25 in all years (men: 0.18–0.23; women: 0.17–0.22). Overall, the nar findings indicated inadequate intake of vitamin a, vitamin d, calcium, zinc, folate, and vitamin b12 in the elderly, while iron and most b vitamins were within acceptable intake levels. The mar results further showed that the elderly’s overall dietary adequacy was below the desired value in all years of the study (figure 3). In 2019, the mar values were 0.61 in men and 0.55 in women, with similar values observed in 2020 (0.61 and 0.56, respectively). A slight decrease in overall dietary adequacy was observed, with mar reaching 0.59 in men and 0.54 in women in 2021. This downward trend intensified in 2022, with the mar for men decreasing to 0.56 and for women to 0.51. In all years of the study, the mar value in women was consistently lower than that of men. Overall, mar values ranged from 0.51 to 0.61, indicating that, on average, only about 51–61% of the cumulative adequacy of the studied micronutrients was provided in the elderly diet. Complete nar and mar results for all assessed nutrients are presented in supplementary table 3.
3.2 analysis 2: estimated daily dietary intake from cohort studies (tlgs and blas)
3.2.1 food group intake patterns
dietary intake patterns from the two cohort studies are presented in tables 1, 2, revealing considerable within-cohort variability.
in the tlgs cohort, mean (±sd) daily intake of fruits and vegetables was 384.5 ± 299.0 g/day and 299.8 ± 171.8 g/day, respectively. The very large standard deviation for fruit intake highlights wide individual variation. In the blas cohort, the intake was 56.2 ± 104.5 g/day for fruits and 108.5 ± 70.2 g/day for vegetables. The standard deviation for fruit intake in blas is nearly double the mean, indicating a highly skewed distribution. Dairy consumption showed high variability in both cohorts: 278.7 ± 184.6 g/day in tlgs and 115.3 ± 219.0 g/day in blas.
3.2.2 energy, macro- and micronutrient intake
as shown in table 2, mean daily energy and nutrient intakes differed between the tlgs and blas cohorts, with notable variability in both cohorts. In the blas cohort, reported energy intake was higher (2,466 kcal/day) than in tlgs (1938 kcal/day). Despite differences in daily energy intake, the contributions of macronutrients to total energy intake (carbohydrates, protein, and fat) fell within recommended ranges in both cohorts. Dietary fiber intake in tlgs (37 g/day) was significantly higher than in blas (14 g/day).
regarding mineral intake, calcium intake was below the recommended level (1,200 mg/day) in both cohorts. In contrast, iron intake exceeded the recommended amount in both studies. In the tlgs cohort, vitamin d intake was critically low. Vitamin a intake in this study exhibited substantial variability. Intake of b vitamins showed mixed patterns. The key finding of both studies was the high variability in nutrient intake, indicating that mean values conceal a wide spectrum of nutritional statuses, ranging from deficiency to adequate or even excessive intake, among oas.
3.2.3 sex-related differences in energy and nutrient intake among oas
as shown in figure 2, in the tlgs cohort, the mean daily energy intake among men was 2076 kcal (95% ci: 2032.1, 2119.9), significantly higher than the intake reported for women (1818 kcal; 95% ci: 1781.2, 1854.8). This pattern was repeated in the blas cohort, where men repeated a mean daily energy intake of 2,555 kcal (95% ci: 2425.8, 2684.2), compared to women (2,387 kcal; 95% ci: 2282.1, 2491.9). Similar sex-based differences were observed for other macronutrients. The non-overlapping 95% confidence intervals for most comparisons between men and women within each cohort confirm that these differences are statistically significant. These findings indicate persistent sex-related disparities in dietary intake patterns among iranian oas across different geographical regions.
in the tlgs cohort, daily mean calcium intake was 959 mg for men and 892 mg for women. In the blas cohort, corresponding values were 1,079 mg for men and 979 mg for women. Zinc intake followed a similar pattern, with higher mean intakes among men in both tlgs (12.1 mg vs. 10.4 mg) and blas (13.2 mg vs. 12.3 mg).
vitamin a intake in the tlgs cohort was relatively higher than that observed in other micronutrients, with mean values of 663 ?G/day for men and 696 ?G/day for women; however, despite these averages, a substantial proportion of participants in both sexes failed to meet recommended intake levels. Folate intake in the tlgs cohort was 504 ?G for men and 437 ?G for women. Sex-specific detailed nutrient intakes for tlgs and blas are available in supplementary table 2.
clear sex-based differences in energy and macronutrient intake were observed in both cohort studies, with men consistently reporting higher intakes than women (figure 2). Also, a persistent sex-related gap was observed across most nutrients in both cohorts. The observed gaps suggest that older women may be at greater risk of inadequate intake for several key nutrients.
4 discussion
the present study provides a comprehensive, population-based description of the adequacy of food group and nutrient intake among iranian oas, using evidence from iheis and two cohort studies (tlgs and blas). To our knowledge, this is the first national-level attempt to estimate the adequacy of food group and nutrient intakes specifically among oas in iran. The findings revealed clear structural weaknesses in the dietary patterns of the elderly in iran and indicated a level of nutritional inadequacy in this group that goes beyond minor deviations from the recommended intake.
4.1 food groups intake
oas exhibited a predominantly grain-based dietary pattern with limited diversity. This pattern is consistent with the macroeconomic context, as existing evidence indicates that lower gross domestic product (gdp) is associated with reduced consumption of fruits and meats, while higher inflation is linked to an increased reliance on grains (such as bread, rice, and pasta) (16). A high reliance on such a calorie-dense but nutrient-poor dietary pattern can lead to deficiencies in high-quality protein, iron, and b vitamins, causing malnutrition and various diseases such as sarcopenia and other chronic diseases in oas (17).
in both the iheis and blas datasets, intakes of fruits, vegetables, dairy products, and meat were below recommended levels, whereas only the tlgs cohort showed fruit and vegetable intakes exceeding reference values—likely reflecting structural differences in the demographic characteristics, food access, and socioeconomic profiles of participants in this cohort. Research across different regions has reported similar findings on food group intake among the elderly populations (18–20). The adherence to recommendations was associated with younger age, higher education, and health-promoting behaviors (21). The consistency of study results across regions, despite cultural and methodological differences, demonstrates that the elderly are at increased risk of aging-related nutrition-related problems (22). This process often involves declines in oral function, appetite, financial capacity, social engagement, and dietary autonomy, which together reduce dietary quality. Inadequate consumption of food groups places older individuals at risk of malnutrition, which is strongly associated with increased mortality and morbidity (23).
the world health organization (who) recommends a daily intake of 400 g of fruits and vegetables to reduce the risk of chronic diseases, including cardiovascular disease, cancer, diabetes, and obesity (24). Beyond reducing all-cause mortality, adequate fruit and vegetable intake among oas is associated with lower rates of hypertension, atherosclerosis, stroke, and frailty (the latter through improvements in bone density and muscle strength). These effects are attributable to the high content of carotenoids, antioxidants, vitamins, and minerals of fruits and vegetables (25). Several factors have been associated with low fruit and vegetable consumption, including demographic characteristics, social factors, disease status, mental health, lifestyle behaviors, and cognitive and psychosocial factors (26–28). In iran, higher age, greater education and welfare, lower prices, and greater accessibility have been directly linked to fruit and vegetable consumption among the elderly. Married oas also consumed more vegetables than widowed or divorced individuals, confirming the role of family and social support in fruit and vegetable consumption among the elderly (29).
the united states department of agriculture (usda) recommends consuming three cups of dairy products daily, including milk, yogurt, and cheese (30). In this study, dairy intake appears lower in older age groups, particularly among individuals aged ? 80 years. Preliminary evidence suggests an inverse association between low-fat milk consumption and the incidence of both frailty and alzheimer’s disease (31). Low dairy product intake may be related to a variety of factors, including decreased personal health awareness, a higher prevalence of lactose intolerance and indigestion, changes in taste and palatability, attempts to reduce fat intake, age-related anorexia, or even financial constraints and the accessibility of dairy products (32).
lean meat consumption is also emphasized in the dietary guidelines as part of a healthy dietary pattern (30). Meat is a dense source of essential nutrients—including protein, heme iron, vitamin b12, zinc, and specific fatty acids—that supports the maintenance of muscle mass and strength in aging populations (33). Evidence indicates that meat consumers show lower prevalence of micronutrient inadequacy (34). Therefore, adequate meat consumption could play a vital role in reducing malnutrition among the elderly. In iran, economic conditions strongly influence the affordability and consumption of foods, including fish, meat, and dairy products as a dietary protein source, among the elderly (35).
improving diet quality through food-based rather than nutrient-based approaches has demonstrated stronger and more consistent associations with reduced risk of adverse health outcomes (36). Diets that effectively prevent chronic diseases, such as diabetes, typically emphasize unprocessed foods from five core food groups: fruits, vegetables, grains, dairy, and meat or their alternatives. Consequently, chronic disease management guidelines in several countries recommend adherence to national food dietary guidelines structured around these food groups (37, 38).
4.2 macro- and micronutrient intake
the macronutrient intake estimates derived from the two cohort studies differed substantially from those obtained through the iheis data. Mean energy intake was higher in the blas compared with the tlgs; however, the proportional contribution of protein to total energy intake was lower, and the share of fat was higher in the blas. The tlgs participants, in contrast, demonstrated a more favorable nutrient profile with higher fiber intake and lower saturated fat consumption. Notably, only the blas cohort reported energy intakes aligned with the estimated energy requirements of oas. In contrast, the iheis data showed a declining trend in energy intake over the 4 years examined, a pattern observed for other macronutrients and fiber. The findings from the three sources reviewed in this study indicated heterogeneity in the nutritional intakes of the iranian elderly. Heterogeneities in macronutrient intake observed across studies and regions may be attributable to broader socioeconomic shifts—including economic development, modernization, and urbanization—that influence food availability, dietary preferences, and consumption patterns across iran (39, 40). Overall, the macronutrient profiles across the three data sources indicated a suboptimal dietary pattern among iranian oas (table 1).
these findings are consistent with those of a study in taiwan that examined trends in macronutrient intake among taiwanese oas (41). The study indicated a fluctuating trend in energy inadequacy among the elderly across survey cycles, alongside a decline in mean energy intake. Unlike the present study, in which the proportional contributions of carbohydrates, fats, and proteins remained fairly stable and largely within recommended ranges, the taiwanese study showed increasing shares of these macronutrients over time. Identifying the causes of low energy intake in oas is challenging due to inconsistent malnutrition data and frequent reliance on assumed body weights in analyses. These assumptions may have led to over- or underestimation of energy requirements in both sexes. Methodological considerations should also address energy underreporting in dietary assessments; underreporting among community-dwelling oas has been estimated at 10–15% (42).
despite meeting mean intake targets, the protein quality in this elderly population appears suboptimal due to low consumption of high-quality sources and a heavy reliance on cereals. This dietary pattern, coupled with evidence that current protein recommendations may be insufficient to counteract age-related muscle loss, raises concerns about the risk of sarcopenia (43). While total fat intake among iranian oas was within the recommended range, the fatty acid profile was imbalanced, indicating poor fat quality. Furthermore, although sfa intake was low, intake of unsaturated fats (mufa/pufa) was inadequate, likely due to high consumption of solid/hydrogenated fats and low consumption of fish, olive oil, and nuts (44). In addition, economic and availability constraints may further limit access to these foods.
this study also revealed that the mean dietary fiber intake was consistently below the adequate intake (ai) for all age and sex groups of oas. This inadequacy likely reflects low consumption of whole grains, legumes, nuts, fresh fruits, and vegetables in the iranian diet. Given that factors such as altered gastrointestinal motility, polypharmacy, and low-fiber dietary patterns contribute to constipation among oas (45), increasing dietary fiber may offer symptomatic benefits. In the absence of strong age-specific evidence, adherence to the current ai for men and women is recommended (46).
the present findings demonstrated a heterogeneous pattern of micronutrient adequacy among iranian oas. Calcium intake in both cohorts exceeded the iheis; however, in neither study was the recommended level met. This aligns with the generally low consumption of dairy products across all three databases. A similar downward trend was observed for zinc, with insufficient intake documented across the datasets examined. Also, intakes of vitamins a, b2, and d were below the recommended levels in both the tlgs cohort and the iheis, although the values obtained for vitamins a and d in the tlgs were much higher than those in the iheis. Furthermore, vitamin b9 and b12 intakes in the iheis fell below recommended levels. This pattern is consistent with evidence from other countries as well. A study of oas in malaysian agricultural regions found that intakes of vitamins b2, b9, a, and d, as well as calcium, were significantly below national recommendations (47). This alignment was also observed in a study by jafar et al. In both rural and urban areas (48). These findings demonstrated a significant risk of micronutrient deficiencies among oas, which can lead to health issues.
the elevated calcium requirements after age 50—from 800 mg to 1,000 mg per day—reflect age-related declines in intestinal calcium absorption. Inadequate intake in older age is clinically relevant, as insufficient calcium intake is strongly associated with osteoporosis and its downstream consequences, which can be particularly debilitating in late life (49). Beyond calcium, zinc has emerged as a potential target micronutrient in mitigating age-related muscle loss and delaying the onset of physical functional decline and frailty. The concurrent inadequacy of calcium and zinc, as observed in this study, may accelerate the trajectory of frailty and impaired physical performance among oas (50).
inadequate intake of vitamins b9 and b12 can impair homocysteine metabolism, elevating a key risk factor for age-related vascular disease, cognitive decline, and osteoporosis (51–55). Numerous studies have documented an increase in folate and vitamin b12 deficiencies with advancing age (56). Atrophic gastritis—which affects more than 50% of oas, with even higher prevalence in asian populations—can impair vitamin b12 absorption (57). Inadequate folate intake among oas may result from substantial losses during cooking, particularly boiling vegetables (with reductions of up to 80%), or from difficulty chewing grains, which serve as major dietary sources of folate (58). Dairy products and meat are the primary dietary sources of vitamin b12 (59); however, consistent with the present study’s findings, the dietary intake of these food groups among iranian oas appears insufficient. Public health interventions—ranging from targeted nutrition education to appropriate supplementation—are essential for mitigating the adverse health consequences of insufficient micronutrient intake.
4.3 age-related energy and nutrient intakes
the dietary intake of iranian oas showed a clear age-related decline in both quantity and quality over the study period. Energy, macronutrients, and essential fatty acids decreased progressively, with the most severe reductions observed in the oldest age groups. Micronutrient intake was broadly inadequate, with severe and progressive deficiencies in vitamins a, d, b2, b9, and b12, as well as key minerals, among the elderly, particularly the oldest-old. Declining vitamin c levels further reflected low consumption of fruits and vegetables.
these findings align with results of a german study conducted among “young-old,” “old-old,” and “very-old” adults, in which the intake of several nutrients—including calcium among men, and fiber, calcium, and vitamins b1, c, and a overall—declined with increasing age (60). A large chinese study of adults over 80 found similar patterns: widespread inadequacies in energy, protein, vitamins a, b2, and folate, with intakes declining with age—in line with the present findings (61). Overall, direct comparisons across studies are difficult due to methodological variations, including differences in dietary assessment tools and nutrient databases, as well as heterogeneity in study sample characteristics—such as age distribution, health status, nutritional risk, and activity levels—which may influence nutrient requirements and intake patterns.
4.4 sex-specific patterns of nutrient intake and nutritional adequacy among iranian oas
the results of this study revealed a persistent pattern of nutrient inadequacy among iranian oas, as reflected in both iheis and tlgs/blas cohort data, which is frequently compounded by significant sex-based disparities. In iheis, a comparative analysis across years suggests that although men consistently consumed more energy and protein than women, the nar for many micronutrients remains low in both sexes, with deficiencies generally more severe among women. Particularly notable are inadequate intakes of vitamins a, d, b2, b9, b12, and c, as well as key minerals such as calcium, phosphorus, and zinc, with intake levels of 30–50% of daily requirements. This pattern of insufficient intake persists consistently across all years examined.
the mar index, an overall indicator of dietary adequacy, further underscores the poor nutritional status of iranian oas. Across all years, mar values remained below 0.6 in men and 0.55 in women, indicating widespread inadequate nutrient intake and poor overall diet quality among iranian oas. The consistently downward trend in mar over time reflects a gradual deterioration in dietary quality. A comparison of iheis findings with those from the tlgs and the blas offers a clearer picture of the gap between actual and optimal intake. In tlgs and blas, due to food-recall-based methods, energy, protein, and a large proportion of micronutrient intakes are reported to be significantly higher than in iheis. For instance, energy intake in the blas cohort exceeded 2,500 kcal for men and more than 2,300 kcal for women, whereas the iheis reported values below 1700 kcal for men and 1,500 kcal for women. Despite this discrepancy, even in these higher-quality studies, micronutrient deficiencies—particularly calcium, vitamin d, vitamins b9, and b12—are consistently observed.
consistent with the findings of the present study, a cross-sectional survey conducted in korea among older men and women found lower nar levels for vitamin a, riboflavin, and calcium, and these inadequacies increased with age. In this population, the mar index showed a marked decline in the oldest age group (62). Similarly, in a study of adults aged over 65 years from five regions of uganda, nar levels for vitamin a, vitamin b12, and calcium were notably low across all participants. The mar index was about 60% (63).
the results of the present study showed that the consumption of nutrient-dense food groups was inadequate among iranian oas. Animal-source foods, such as meat and dairy, provide essential nutrients for optimal physiological function (64). Globally, low intake of vitamin and mineral-rich foods, including fruits and vegetables, is associated with a higher proportion of diet-related mortality (65). Several studies have emphasized that socioeconomic and demographic factors—such as age, place of residence, education level, and income—significantly affect the nutrient adequacy in the older population (66, 67). Consistent with these observations, the dietary pattern of iranian oas is primarily grain- and starch-based, likely due to region-specific socioeconomic and demographic factors.
the simultaneous use of three data sources—two well-established cohort studies, including tlgs in tehran (the capital) and blas in eastern iran, and the national iheis database—is one of this study’s most important strengths. This geographical and methodological diversity allowed for a multidimensional picture of the dietary intake patterns of iranian oas. Using individual-based data from the cohorts, alongside household-based iheis data, increased the analysis power and enabled comparisons between observed consumption patterns and estimates derived from dietary recall.
in contrast, the substantive differences among these three data sources—including data collection instruments, measurement level (individual versus household), and methods of estimating consumption—are key limitations, and direct comparisons of consumption values should be made with caution. The tlgs and blas are based on individual self-report instruments, whereas the iheis estimates household-level consumption from food purchases. The iheis data do not necessarily reflect actual household oa consumption and may underestimate or overestimate micronutrient intake. Also, the limited geographic coverage of the two cohorts limits the ability to fully generalize the results to the entire country. Other limitations of this study include common errors in dietary recall instruments, inconsistent data for some micronutrients, and a lack of direct information on contextual factors such as price, availability, and food preferences. The cross-sectional study design also makes it difficult to determine cause-and-effect relationships.
5 conclusion
this study provides a comprehensive assessment of dietary intake patterns and nutrient adequacy in iranian oas, integrating national data (iheis) and two cohort studies (tlgs and blas). Findings indicated a significant gap between actual and recommended intakes, particularly for key micronutrients such as calcium, vitamin d, folate, vitamin b12, vitamin a, and zinc. Despite higher energy and macronutrient intakes in the cohort studies, overall diet quality remains poor. The predominant dietary pattern of iranian oas is based on grains and starches, and the consumption of nutrient-rich foods, including dairy, meat, fruits, and vegetables, is low. The decline in energy and nutrient intake with age and gender differences identifies vulnerable groups in the elderly population. The findings also highlight the role of socioeconomic, demographic, and regional factors in nutritional adequacy. Disparities among studies may highlight a concerning gap in dietary habits within the populations represented by iheis and blas, which may necessitate targeted public health interventions. Overall, the study results emphasized the need for targeted nutrition interventions, including nutrition education, improved access to nutrient-rich foods, and, where appropriate, supplementation programs, to reduce micronutrient deficiencies and support healthy aging. Implementing evidence-based policies tailored to the characteristics of the iranian elderly population is essential for improving diet quality and reducing the risk of nutrition-related diseases.
statements
data availability statement
the datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/supplementary material.
ethics statement
the tehran lipid and glucose study (tlgs) and the birjand longitudinal aging study (blas) had previously been approved by the ethics committees of their respective institutions. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study.
author contributions
as: conceptualization, data curation, formal analysis, investigation, methodology, software, visualization, writing – original draft, writing – review & editing. No: conceptualization, data curation, methodology, project administration, supervision, validation, writing – review & editing. Dg: conceptualization, data curation, formal analysis, methodology, project administration, supervision, writing – review & editing. He-z: conceptualization, methodology, validation, writing – review & editing. Fs: data curation, formal analysis, methodology, writing – review & editing. Ar: conceptualization, investigation, methodology, project administration, resources, supervision, validation, writing – original draft, writing – review & editing.
funding
the author(s) declared that financial support was received for this work and/or its publication. The study is funded by the national nutrition and food technology research institute and the faculty of nutrition sciences and food technology, shahid beheshti university of medical sciences, tehran, iran (grant number: 43006525).
acknowledgments
the authors thank the statistical center of iran (sci) for providing the iran household expenditure and income survey (iheis) data. We are also grateful to the investigators, staff, and participants of the tehran lipid and glucose study (tlgs) and the birjand longitudinal aging study (blas). We acknowledge the research teams at the research institute for endocrine sciences, shahid beheshti university of medical sciences (tlgs), and the birjand university of medical sciences (blas) for their collaboration and data sharing.
conflict of interest
the author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
generative ai statement
the author(s) declared that generative ai was used in the creation of this manuscript. The authors acknowledge the use of an ai-powered large language model (specifically, chatgpt-4) solely to assist with english language editing and refinement of the manuscript text. All study conception, design, data analysis, interpretation of results, and scientific conclusions are the original work of the human authors. The ai tool was not used in any phase of study design, data collection, data processing, statistical analysis, or result interpretation.
any alternative text (alt text) provided alongside figures in this article has been generated by frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
publisher’s note
all claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
supplementary material
the supplementary material for this article can be found online at: https://www.Frontiersin.Org/articles/10.3389/fnut.2026.1808784/full#supplementary-material
references
1.
united nations. Department of international economic and social affairs. World population ageing, 2013. New york: united nations (2014).
2.
world health organization. World report on ageing and health. Geneva: world health organization (2015).
3.
bojangkpmanchanav. Nutrition and healthy aging: a review. Curr nutr rep. (2023) 12:369–75. Doi: 10.1007/s13668-023-00473-0,
4.
mcevoyctmcclurecd. Nutrition resilience for healthy ageing, vol. 53. Oxford city: oxford university press (2024). P. Ii1.
5.
dericiogludmethvenlcleggme. Understanding age-related changes: exploring the interplay of protein intake, physical activity and appetite in the ageing population. Proc nutr soc. (2024) 84:303–15. Doi: 10.1017/s0029665124002192,
6.
sahasbehnkeaoldewage-theronwmubtasimnmillerm. Prevalence and factors associated with food insecurity among older adults in sub-saharan africa: a systematic review. J nutr gerontol geriatr. (2021) 40:171–96. Doi: 10.1080/21551197.2021.1988027,
7.
shliskyjbloomdebeaudreaultartuckerklkellerhhfreund-leviyet al. Nutritional considerations for healthy aging and reduction in age-related chronic disease. Adv nutr. (2017) 8:17–26. Doi: 10.3945/an.116.013474,
8.
aliabadimkimiagarmghayour-mobarhanmshakerimtnematymilatyaaet al. Prevalence of malnutrition in free living elderly people in iran: a cross-sectional study. Asia pac j clin nutr. (2008) 17:285–9.
9.
vaisi-rayganiamohammadimjalalirghobadiasalarin. The prevalence of obesity in older adults in iran: a systematic review and meta-analysis. Bmc geriatr. (2019) 19:371. Doi: 10.1186/s12877-019-1396-4,
10.
statistical center of iran. (2019). Household, expenditure and income. Available online at:
https://www.Amar.Org.Ir/english/metadata/statistical-survey/household-expenditure-and-income11.
weisellrdopmc. The adult male equivalent concept and its application to household consumption and expenditures surveys (hces). Food nutr bull. (2012) 33:s157–62. Doi: 10.1177/15648265120333s203,
12.
faoj. Human energy requirements: report of a joint fao/who/unu expert consultation. Food nutr bull. (2005) 26:166.
13.
gustafssonjcederbergcsonessonuemanuelssona. The methodology of the fao study: global food losses and food waste-extent, causes and prevention-fao, 2011. Sik institutet för livsmedel och bioteknik. (Sik report no. 857). (2013)
14.
ghaffarpourmhoushiar-radakianfarh. The manual for household measures, cooking yields factors and edible portion of foods, vol. 7tehran: nashre olume keshavarzy (1999). P. 42–58.
15.
mirmiranpesfahanifhmehrabiyhedayatimazizif. Reliability and relative validity of an ffq for nutrients in the tehran lipid and glucose study. Public health nutr. (2010) 13:654–62. Doi: 10.1017/s1368980009991698,
16.
rahbarinejadpsobhanisrsangsefidinirankhahkmohamadinarabm. Exploring the association between socio-economic and environmental factors and food consumption in iran: insights from time series data. Bmc public health. (2025) 25:2289. Doi: 10.1186/s12889-025-23437-1,
17.
bealtortenziffanzoj. Estimated micronutrient shortfalls of the eat–lancet planetary health diet. Lancet planet heath. (2023) 7:e233–7. Doi: 10.1016/s2542-5196(23)00006-2,
18.
maniosymoschonisggrammatikakiemavrogiannicvan den heuvelebosret al. Food group and micronutrient intake adequacy among children, adults and elderly women in greece. Nutrients. (2015) 7:1841–58. Doi: 10.3390/nu7031841,
19.
jiménez-redondosde miguelbbgómez-pavónjvivescc. Food consumption and risk of malnutrition in community-dwelling very old spanish adults (? 80 years). Nutr hosp. (2016) 33:572–9. Doi: 10.20960/nh.263
20.
zhukdevineasuleskaatancytohczjkerrdet al. Adequacy and change in nutrient and food intakes with aging in a seven-year cohort study in elderly women. J nutr health aging. (2010) 14:723–9. Doi: 10.1007/s12603-010-0324-2,
21.
bolbinskipnascimento-souzamalima-costamfpeixotosv. Consumption of fruits and vegetables among older adults: findings from the elsi-brazil study. Cad saude publica. (2023) 39:e00158122. Doi: 10.1590/0102-311xen158122,
22.
starrknpmcdonaldsrbalescw. Nutritional vulnerability in older adults: a continuum of concerns. Curr. Nutr. Rep. (2015) 4:176–84. Doi: 10.1007/s13668-015-0118-6,
23.
cleggmewilliamsea. Optimizing nutrition in older people. Maturitas. (2018) 112:34–8. Doi: 10.1016/j.Maturitas.2018.04.001,
24.
world health organization. Diet, nutrition, and the prevention of chronic diseases: report of a joint who/fao expert consultation. Geneva: world health organization (2003).
25.
nicklettejkadellar. Fruit and vegetable intake among older adults: a scoping review. Maturitas. (2013) 75:305–12. Doi: 10.1016/j.Maturitas.2013.05.005,
26.
kamphuiscbgiskeskde bruijng-jwendel-voswbrugjvan lenthef. Environmental determinants of fruit and vegetable consumption among adults: a systematic review. Br j nutr. (2006) 96:620–35. Doi: 10.1079/bjn20061896
27.
liylidmac-yliucyhui-dingwenzmet al. Consumption of, and factors influencing consumption of, fruit and vegetables among elderly chinese people. Nutrition. (2012) 28:504–8. Doi: 10.1016/j.Nut.2011.07.023,
28.
peltzerkphaswana-mafuyan. Fruit and vegetable intake and associated factors in older adults in south africa. Glob health action. (2012) 5:1–8. Doi: 10.3402/gha.V5i0.18668,
29.
salehileftekharhmohammadktavafianssjazayeryamontazeria. Consumption of fruit and vegetables among elderly people: a cross sectional study from iran. Nutr j. (2010) 9:2. Doi: 10.1186/1475-2891-9-2,
30.
phillipsja. Dietary guidelines for americans, 2020–2025. Workplace health safety. (2021) 69:395. Doi: 10.1177/21650799211026980,
31.
cuesta-trianafverdejo-bravocfernández-pérezcmartín-sánchezfj. Effect of milk and other dairy products on the risk of frailty, sarcopenia, and cognitive performance decline in the elderly: a systematic review. Adv nutr. (2019) 10:s105–19. Doi: 10.1093/advances/nmy105,
32.
ribeiroigomesmfigueiredodlourençojpaúlccostae. Dairy product intake in older adults across europe based on the share database. J nutr gerontol geriatr. (2019) 38:297–306. Doi: 10.1080/21551197.2019.1627972,
33.
bohrerbm. Nutrient density and nutritional value of meat products and non-meat foods high in protein. Trends food sci technol. (2017) 65:103–12. Doi: 10.1016/j.Tifs.2017.04.016
34.
agarwalsfulgonivliii. Beef consumption is associated with higher intakes and adequacy of key nutrients in older adults age 60+ years: national health and nutrition examination survey 2011–2018 analysis. Nutrients. (2024) 16:1779. Doi: 10.3390/nu16111779,
35.
dehnavimkabbasihhajianpnmotlaghadazadbakhtl. Adherence to the planetary health diet reduces dietary costs by 21% supporting affordable healthy eating among older adults in iran. Sci rep. (2025) 15:9586. Doi: 10.1038/s41598-025-93835-3,
36.
fardetaboiriey. Associations between food and beverage groups and major diet-related chronic diseases: an exhaustive review of pooled/meta-analyses and systematic reviews. Nutr rev. (2014) 72:741–62. Doi: 10.1111/nure.12153,
37.
chengaylaudc. The canadian diabetes association 2013 clinical practice guidelines—raising the bar and setting higher standards!Can j diabetes. (2013) 37:137–8. Doi: 10.1016/j.Jcjd.2013.04.005,
38.
dysonpkellytdeakintduncanafrostgharrisonzet al. Diabetes uk evidence-based nutrition guidelines for the prevention and management of diabetes. Diabet med. (2011) 28:1282–8. Doi: 10.1111/j.1464-5491.2011.03371.X,
39.
mukhopadhyaykthomassinpj. Economic impact of adopting a healthy diet in canada. J public health. (2012) 20:639–52. Doi: 10.1007/s10389-012-0510-2
40.
daijsriboonchittaszicyangy. A study on whether economic development and urbanization of areas are associated with prevalence of obesity in chinese adults: findings from 2009 china health and nutrition surveys. Modeling dependence in econometrics: selected papers of the seventh international conference of the thailand econometric society, faculty of economics, chiang mai university, thailand, january 8–10, 2014; (2014) 289–305.
41.
linc-hchangh-ylit-cliucslinwyleemcet al. Trends in energy and macronutrient intake among taiwanese older adults in 1999–2000, 2005–2008 and 2013–2016 periods. Bmc public health. (2023) 23:871. Doi: 10.1186/s12889-023-15810-9,
42.
de vriesjde grootlvan staverenw. Dietary assessment in elderly people: experiences gained from studies in the netherlands. Eur j clin nutr. (2009) 63:s69–74. Doi: 10.1038/ejcn.2008.68,
43.
bauerjbiologcederholmtcesarimcruz-jentoftajmorleyjeet al. Evidence-based recommendations for optimal dietary protein intake in older people: a position paper from the prot-age study group. J am med dir assoc. (2013) 14:542–59. Doi: 10.1016/j.Jamda.2013.05.021,
44.
ongswoojparikhpchanrsunjmuncyet al. Addressing nutritional requirements of ageing consumers in asia-recommendations from an expert workshop. Asia pac j clin nutr. (2019) 28:204–13. Doi: 10.6133/apjcn.201906_28(2).0001,
45.
gandelldstraussebundookwalamtsuivalibhaismh. Treatment of constipation in older people. Cmaj. (2013) 185:663–70. Doi: 10.1503/cmaj.120819,
46.
dorringtonnfallaizerhobbsdaweechmlovegroveja. A review of nutritional requirements of adults aged? 65 years in the uk. J nutr. (2020) 150:2245–56. Doi: 10.1093/jn/nxaa153,
47.
zainudinnhamirudinahsideksrahmannaa. Dietary intake is compromised among elderly living in agricultural settlements. Nutr. Food sci. (2019) 50:314–23. Doi: 10.1108/nfs-01-2019-0028
48.
ja’afarmmatnmdzismailrmohdaismailnet al. Dietary nutrient intake study among older adults: baseline malaysian pure study. Bmc geriatr. (2024) 24:441. Doi: 10.1186/s12877-024-05042-w,
49.
betoja. The role of calcium in human aging. Cnr. (2015) 4:1–8. Doi: 10.7762/cnr.2015.4.1.1,
50.
ganapathya. Nieves jw. Nutrition and sarcopenia-what do we know?Nutrients. (2020) 12:1755. Doi: 10.3390/nu12061755,
51.
reynoldseh. Folate, vitamin b12, one carbon metabolism and the nervous system. J neurol sci. (2025) 476:123627. Doi: 10.1016/j.Jns.2025.123627,
52.
walddslawmmorrisjk. Homocysteine and cardiovascular disease: evidence on causality from a meta-analysis. Bmj. (2002) 325:1202. Doi: 10.1136/bmj.325.7374.1202,
53.
agnolicgrioniskroghvpalavallioneamatulloget al. Plasma riboflavin and vitamin b-6, but not homocysteine, folate, or vitamin b-12, are inversely associated with breast cancer risk in the european prospective investigation into cancer and nutrition-varese cohort123. J nutr. (2016) 146:1227–34. Doi: 10.3945/jn.115.225433,
54.
mafwutzhaojjilsongazhangmet al. Plasma homocysteine and serum folate and vitamin b12 levels in mild cognitive impairment and alzheimer’s disease: a case-control study. Nutrients. (2017) 9:725. Doi: 10.3390/nu9070725,
55.
garcia lopezmbønaakhebbingmeriksenefgjesdalcgnygårdoet al. B vitamins and hip fracture: secondary analyses and extended follow-up of two large randomized controlled trials. J bone miner res. (2017) 32:1981–9. Doi: 10.1002/jbmr.3189,
56.
zhangcluojyuancdingd. Vitamin b12, b6, or folate and cognitive function in community-dwelling older adults: a systematic review and meta-analysis. J alzheimers dis. (2020) 77:781–94. Doi: 10.3233/jad-200534,
57.
aomtanakattsudamazumamkawashitackomedamet al. Impaired vitamin b12 status in atrophic gastritis. Can j diet pract res. (2024) 85:244–5.
58.
holmesbrobertsc. The influence of social and physical factors and out-of-home eating on food consumption and nutrient intake in the materially deprived older uk population. Kings college london: london, uk (2009).
59.
brouwer-brolsmaemdhonukshe-ruttenravan wijngaardenjpvan der zwaluwnlvan der veldende grootlcpgm. Dietary sources of vitamin b-12 and their association with vitamin b-12 status markers in healthy older adults in the b-proof study. Nutrients. (2015) 7:7781–97. Doi: 10.3390/nu7095364,
60.
volkertdkreuelkhesekerhstehlep. Energy and nutrient intake of young-old, old-old and very-old elderly in germany. Eur j clin nutr. (2004) 58:1190–200. Doi: 10.1038/sj.Ejcn.1601950,
61.
zhaofhelzhaolguoqyudjulet al. The status of dietary energy and nutrients intakes among chinese elderly aged 80 and above: data from the cacdns 2015. Nutrients. (2021) 13:1622. Doi: 10.3390/nu13051622,
62.
kimhhwangj-ykwono. Dietary reference intakes for koreans with special consideration to older adults. Nutr res pract. (2022) 16:s1–s10. Doi: 10.4162/nrp.2022.16.S1.S1,
63.
omokoj. (2024) dietary intake and associated factors among elderly persons receiving social assistance grant for empowerment (sage) in northern uganda.
64.
gorissenshcrombagjjsendenjmwatervalwbieraujverdijklet al. Protein content and amino acid composition of commercially available plant-based protein isolates. Amino acids. (2018) 50:1685–95. Doi: 10.1007/s00726-018-2640-5,
65.
okopkjndayiktsolekilelsandersdpuoanet. Low intake of commonly available fruits and vegetables in socio-economically disadvantaged communities of south africa: influence of affordability and sugary drinks intake. Bmc public health. (2019) 19:940. Doi: 10.1186/s12889-019-7254-7,
66.
bonnefoymberrutglesourdbferrymgilberttguerinoet al. Frailty and nutrition: searching for evidence. J nutr health aging. (2015) 19:250–7. Doi: 10.1007/s12603-014-0568-3,
67.
pourebrahimfomidvarnrezazadehaeini-zinabhshiranipghodsid. Food security and its association with socioeconomic status and dietary diversity in free living older people in tehran, iran. Bmc geriatrics. (2024) 24:128. Doi: 10.1186/s12877-024-04705-y,
68.
jointf.Human energy requirements. Report of a joint fao/who/unu expert consultation, rome, 17–24 october 2001. (2004).
69.
mannjcummingsjenglysthkeytliusriccardiget al. Fao/who scientific update on carbohydrates in human nutrition: conclusions. Eur j clin nutr. (2007) 61:s132–7. Doi: 10.1038/sj.Ejcn.1602943,
70.
world health organization. Protein and amino acid requirements in human nutrition. Geneva: world health organization (2007).
71.
joint fao. Fats and fatty acids in human nutrition. Report of an expert consultation, 10–14 november 2008, geneva. (2010).
72.
meyersldhellwigjpottenjj. Dietary reference intakes: the essential guide to nutrient requirements. Washington, dc: national academies press (2006).
73.
del vallehbyaktinealtaylorclyaktinealdel vallehb. Dietary reference intakes for calcium and vitamin d. Washington, dc: the national academies press (2011).
summary
keywords
older adults, iran, macronutrient, micronutrient, mean adequacy ratio, mean energy intake, nutrient adequacy ratio
citation
shokri a, omidvar n, ghodsi d, eini-zinab h, sharifi f and rezazadeh a (2026) dietary intake adequacy among iranian older adults: evidence from national household survey data and two population-based cohorts. Front. Nutr. 13:1808784. Doi: 10.3389/fnut.2026.1808784
received
11 february 2026
revised
10 june 2026
accepted
11 june 2026
published
26 june 2026
volume
13 - 2026
edited by
justyna godos, university of catania, italy
reviewed by
agnieszka micek, jagiellonian university medical college, poland
mona hashim, university of sharjah, united arab emirates
updates
copyright
© 2026 shokri, omidvar, ghodsi, eini-zinab, sharifi and rezazadeh.
this is an open-access article distributed under the terms of the creative commons attribution license (cc by). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*correspondence: arezoo rezazadeh, arezoo.Rezazadeh@gmail.Com
disclaimer
all claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher. |
| ( Read More... | 142450 bytes more | comments? | ) |
| |
| The Community Answering the College Faith-Abandonment Crisis |
| Posted on Friday, June 26 @ 00:02:41 PDT (6 reads) | |
|
|
A 2007 lifeway study found that 70 percent of young american adults who regularly attended a protestant church in high school stopped attending upon reaching college age. Unhappy with the trend, trace hamiter founded the oaks collaborative in 2012, an interdenominational nonprofit that helps college students build faith communities through retreats. When lifeway repeated the study in 2017, it found similar results, but participant testimonies and the oaks’ growing footprint—reaching nearly 15,000 freshmen and 7,000 student leaders—suggest that the 2027 findings could be more encouraging.
the oaks collaborative invites incoming college students, upperclassmen leaders, and local churches and campus ministries to a three-day retreat before the school year begins. Students participate in activities, hear sermons by local pastors, debrief in small groups led by upperclassmen, and connect with campus and community ministries. Since its founding at auburn university, it has expanded to more than twenty college campuses nationwide, with each retreat bearing a distinct name shaped by a local and biblical vision.
after learning about the oaks retreat during her auburn tour, caitlyn holmes decided to attend the arch retreat as a freshman at the university of georgia. During her sophomore year, she signed up to be a counselor and saw the retreat double in size. “Our prayer is that it would be impossible for freshmen to not know about it,” holmes said.
signing up to be a counselor extends beyond a three-day commitment. Counselors are expected to follow up with their small group members throughout the following semester: remembering birthdays, helping with move-in, offering rides to church. This summer will mark holmes’s third year of involvement.
“i am involved in greek life, and honestly, had i not at first really gotten plugged into ministry, i wouldn’t be surprised if that would have been my biggest commitment,” holmes said. “I don’t think i would have the same level of ministry involvement that i do without it. Yes, i believe i’m at college to get a degree, but . . . How can i grow my faith and how can i minister to those around me? I really think that’s my primary purpose.”
this past year, about 17 percent of auburn’s six-thousand-person freshman class attended the retreat. When the hills retreat began at clemson university, one local church had no college ministry; today, it reaches a few hundred students. At the university of georgia, a ministry that once drew thirty to forty students now regularly reaches three to four hundred.
“i do want to be clear that i would never take credit for that. Those churches are also doing an amazing job,” hamiter said. “We’re trying to blow some wind into the sails of the churches and ministries that are already on campus, and we’re trying to create a situation where we close the back door to the church.”
according to hamiter, the reason students fall away from faith in college is less about the big bad atheist professor who tells his students that god is dead than social dynamics. “They say yes to things they never thought they’d say yes to in those first couple weeks, and that leads them down a path they never thought they’d go down,” hamiter said.
research suggests that the first few weeks of college are especially consequential to a student’s adjustment, relationship building, and habit formation; brandon clark attended the oaks retreat at auburn in 2019 and saw this work out decisively. “Before i even got a chance to live what people think is a great college experience of partying and everything, [the retreat] allowed me to meet and surround myself with people who encouraged and developed me, not only as a christian, but as a man, which i think has greatly impacted what i do for work and how i interact with people,” clark said.
the oaks collaborative helps students see that following christ is not something to postpone until after college, but a path worth pursuing during a student’s most formative years. “One of the things that i say [to students] is that you can trust him, not only with eternity, but also with the next four years of your life,” hamiter said. “Living the life of christ in college is actually more abundant than anything the world has to offer.”
what jd vance found in the church
communion:finding my way back to faithby jd vanceharpercollins, 304 pages, $35 in the sixth book of his…
an evangelical update to just war theory
the first time i heard about just war theory was in my military ethics class. As midshipmen…
leo’s theology of migration
every pope has his defining mission, a papal charism of sorts that characterizes and in time becomes… |
| ( Read More... | 9496 bytes more | comments? | ) |
| |
| 1stHeadlines-Breaking News |
| Posted on Friday, June 26 @ 00:02:41 PDT (7 reads) | |
|
|
Breaking news headlines
search 1stheadlines:
new york (ny) times-national
california will vote on a billionaire tax. Billionaires aren’t happy.
fri jun 26, 2026 12:50 am edt
cbs news-national
u.S. Men suffer first 2026 world cup loss to turkey before knockout round
fri jun 26, 2026 12:10 am edt
cnn-us
texas is poised to require millions of students to study bible stories
fri jun 26, 2026 12:10 am edt
cnn-world
rescuers race to find venezuela quake victims as global relief effort gains pace
fri jun 26, 2026 12:10 am edt
new york (ny) post
fbi probes jennifer siebel newsoms taxes as her gender-obsessed nonprofit lost $1m in 5 years
fri jun 26, 2026 12:10 am edt
new york (ny) times-international
in london, you can celebrate america’s 250th birthday from the british side
fri jun 26, 2026 12:10 am edt
cnn-world
power outages, fuel bans and no summer camps: ukraine steps up pressure on russia by targeting crimea
fri jun 26, 2026 12:10 am edt
new york (ny) times-national
climate change fueling europe’s ferocious heat wave, scientists find
fri jun 26, 2026 12:10 am edt
new york (ny) times-national
a $2.5 billion whodunit: the hack that dented the u.K. Economy
fri jun 26, 2026 12:10 am edt
new york (ny) post
maniac who set virginia city councilman on fire in jealous rage over alleged affair learns his fate
fri jun 26, 2026 12:00 am edt
cnn-world
iran strikes vessel, pausing un efforts to evacuate ships from hormuz
fri jun 26, 2026 12:00 am edt
washington (dc) times-world
venezuela death toll nears 235 people, 4,300 injured in catastrophic earthquakes
thu jun 25, 2026 11:50 pm edt
new york (ny) post
owner of vicious dogs arrested after aggressive pack chased boy to his drowning death at california park
thu jun 25, 2026 11:50 pm edt
new york (ny) post
team usa goes down 2-1 after kamala harris husband posts photo of ex-veep at world cup match
thu jun 25, 2026 11:50 pm edt
new york (ny) times-national
here’s what the supreme court’s decision means for tps holders
thu jun 25, 2026 11:10 pm edt
nbc-u.S.
23+ amazon prime day camping deals that make a strong case for sleeping outside from $11
thu jun 25, 2026 10:20 pm edt
new york (ny) times-national
obama says he occupies a ‘suite’ in trump’s head
thu jun 25, 2026 10:20 pm edt
fox news-national
florida executes 74-year-old for wifes murder, becoming oldest inmate put to death in states modern history
thu jun 25, 2026 10:10 pm edt
uk-bbc-world
rescues and prayers a day after venezuelan earthquakes
thu jun 25, 2026 10:10 pm edt
cbs news-national
mangiones attorneys discussed possible plea deal but talks fell apart, sources say
thu jun 25, 2026 10:10 pm edt
nbc-u.S.
359+ impressive amazon prime day 2026 deals to shop on day 3: apple, yeti, lego and more
thu jun 25, 2026 9:50 pm edt
nbc-u.S.
former youth pastor charged in wifes murder dies before court appearance
thu jun 25, 2026 9:50 pm edt
cnn-us
jury to return friday for further instruction after reaching a standstill in palisades fire arson trial
thu jun 25, 2026 9:40 pm edt
uk-bbc-world
rescuers search rubble for survivors as venezuela earthquakes kill at least 235
thu jun 25, 2026 9:40 pm edt
cnn-world
king charles will not live in buckingham palace after costly refit, reveals $17 million tax bill
thu jun 25, 2026 9:30 pm edt
cnn-world
european heat wave brings in cool cash for asian air-conditioner makers as sales surge
thu jun 25, 2026 9:20 pm edt
washington (dc) times-national
rent board fulfills mamdani vow to freeze the rent on 1 million nyc apartments
thu jun 25, 2026 9:00 pm edt
washington (dc) times-national
a surprise deadlocked jury in the palisades fire trial leaves attorneys weighing next steps
thu jun 25, 2026 9:00 pm edt
cnn-us
rent board fulfills mamdani’s vow to freeze the rent on 1 million nyc apartments
thu jun 25, 2026 8:50 pm edt
nbc-u.S.
trump administration sued over daca renewal delays
thu jun 25, 2026 8:40 pm edt
fox news-national
jury deadlocks in federal trial of man accused of starting deadly palisades fire in los angeles
thu jun 25, 2026 8:20 pm edt
cbs news-national
la investigating construction at warehouse involved in massive fire
thu jun 25, 2026 8:20 pm edt
uk-bbc-world
the abundant but expensive energy source thats under your feet
thu jun 25, 2026 8:20 pm edt
nbc-u.S.
21+ amazon prime day camping deals that make a strong case for sleeping outside from $11
thu jun 25, 2026 8:20 pm edt
uk-bbc-world
rescuers search rubble for survivors as venezuela earthquakes kill at least 188
thu jun 25, 2026 8:10 pm edt
uk-bbc-world
paris restricts alcohol consumption and sales as europes heatwave shifts east
thu jun 25, 2026 8:10 pm edt
washington (dc) times-world
leaders and celebrities react after powerful quakes hit venezuela
thu jun 25, 2026 7:50 pm edt
washington (dc) times-world
bigger defense spending to top the agenda at the upcoming nato summit in turkey
thu jun 25, 2026 7:50 pm edt
washington (dc) times-world
king charles iii will not live at buckingham palace after completion of costly refurbishment
thu jun 25, 2026 7:50 pm edt
washington (dc) times-world
things to know about the venezuela earthquakes
thu jun 25, 2026 7:50 pm edt
cbs news-national
luigi mangiones attorneys accuse federal prosecutors of violating his rights
thu jun 25, 2026 7:40 pm edt
cnn-us
luigi mangione’s attorneys discussed plea deal with prosecutors in federal case, source says
thu jun 25, 2026 7:20 pm edt
cnn-us
court in recess until friday after jury said it’s in a standstill in palisades fire arson trial
thu jun 25, 2026 7:20 pm edt
new york (ny) times-international
congo ebola crisis: contact tracing is dangerously behind, officials warn
thu jun 25, 2026 7:10 pm edt
fox news-national
four charged in alleged billion dollar healthcare fraud tied to russian transnational criminal organization
thu jun 25, 2026 7:00 pm edt
washington (dc) times-national
native americans commemorate victory at little bighorn with horse races, dance and song
thu jun 25, 2026 7:00 pm edt
washington (dc) times-national
mother wins appeals-court ruling against n.Y. School for concealing daughters gender switch
thu jun 25, 2026 7:00 pm edt
washington (dc) times-national
montana deq works toward impairment designation for big hole river
thu jun 25, 2026 7:00 pm edt
new york (ny) times-international
hoping for miracles as venezuela digs out from massive quakes
thu jun 25, 2026 6:50 pm edt
cbs news-national
hundreds of veterans snag free world cup tickets
thu jun 25, 2026 6:50 pm edt
fox news-national
exclusive: dhs asks florida not to release illegal immigrant accused of drugging, raping woman after clubbing
thu jun 25, 2026 6:30 pm edt
new york (ny) times-international
iran strikes ship in strait of hormuz, undermining efforts to restore traffic
thu jun 25, 2026 5:40 pm edt
fox news-national
alex murdaughs lawyers withdraw request for civilian clothes, accuse prosecutors of creating a spectacle
thu jun 25, 2026 5:10 pm edt
new york (ny) times-international
iran strikes ship in strait of hormuz as rubio meets gulf leaders
thu jun 25, 2026 4:40 pm edt
cbs news-world
iran strikes ship in strait of hormuz in challenge to u.S.-Iran deal
thu jun 25, 2026 4:20 pm edt
cbs news-world
iran strikes vessel in strait of hormuz amid debate over transit fees
thu jun 25, 2026 3:30 pm edt
cbs news-world
powerful earthquakes strike venezuela, hundreds dead or injured
thu jun 25, 2026 2:40 pm edt
cbs news-world
influencer faces possible execution in dubai after allegedly fatally stabbing man
thu jun 25, 2026 2:20 pm edt
fox news-world
israel slams un report as political blood libel for alleging deliberate targeting of palestinian children
thu jun 25, 2026 06:30 am edt
fox news-world
trump says venezuela earthquakes left devastating number of deaths as us readies aid
thu jun 25, 2026 01:50 am edt
fox news-world
shark attack survivor wakes from 10-day coma and shares first words with family at her hospital bedside
wed jun 24, 2026 8:30 pm edt
fox news-world
colombias el tigre secures presidency as leftist rival finally concedes defeat
wed jun 24, 2026 4:50 pm edt
fox news-world
experts urge extreme caution on irans crown jewel hezbollah terror group with us blood on its hands
wed jun 24, 2026 3:50 pm edt
abc news-national
what happened to vegas dancer debbie flores narvaez
fri apr 17, 2026 08:20 am edt
abc news-world
nigeria students abducted as gunmen attack passenger bus in benue state
fri apr 17, 2026 08:20 am edt
abc news-world
about 15 latin american deportees from the us have arrived in congo, lawyer says
fri apr 17, 2026 08:20 am edt
abc news-world
sri lanka sent home 238 iranian sailors, including survivors of a us torpedo attack
fri apr 17, 2026 08:20 am edt
abc news-world
uk leader starmer says he is furious he wasnt told peter mandelson had failed security checks to be ambassador to us
fri apr 17, 2026 08:20 am edt
abc news-world
a fragile calm in lebanon as a us-brokered truce holds and families head home
fri apr 17, 2026 08:20 am edt
abc news-national
parents of 2-year-old girl who died from fentanyl overdose charged with murder
thu apr 16, 2026 10:50 pm edt
abc news-national
death rates at ice detention facilities raise concerns about health standards: study
thu apr 16, 2026 9:30 pm edt
abc news-national
singer d4vd arrested after teen found dead in his tesla: police
thu apr 16, 2026 9:30 pm edt
abc news-national
we came back as best friends: artemis ii crew reflects on historic moon mission
thu apr 16, 2026 5:00 pm edt
general topics:
more news headlines
al qaeda
animals
auto news
aviation
bargains & deals
bird flu
bridge news
cable tv news
conservative
coronavirus
crimes
cruise news
more cruise news
drone
earthquake
earthquake reports
ebola
education
elections & voting
energy
environment
fema
fire
health
health care
high tech
homeland security
hurricane news
immigration
iphone/ipad
jobs & unemployment
journalism
legal
lifestyles
lottery
mad cow
marine
maritime
marriage
medical
military
mining
money
nasa
nuclear
offbeat news
oil leak
photography
police
rail
senior living
sinkhole
social networking
space
supreme court
swine flu
taxes
technology
terrorism
tornado
travel
tsunami
united nations
volcano
weather news
weather
politics:
politics:
ex-president biden
michael bloomberg
ex-president bush
hillary clinton
tulsi gabbard
lindsey graham
ex-president obama
rand paul
nancy pelosi
ex-vice president pence
bernie sanders
chuck schumer
president trump
vice-president vance
elizabeth warren
sports:
sports:
auto racing
baseball
boxing
college basketball
college football
golf
horse racing
nba
nfl
nhl
olympics
soccer
tennis
country:
africa:
egypt
morocco
liberia
libya
somalia
zimbabwe
americas:
aruba
bolivia
brazil
canada
chile
colombia
costa rica
cuba
haiti
mexico
peru
venezuela
asia:
afghanistan
china
india
indonesia
japan
malaysia
nepal
north korea
south korea
pakistan
philippines
russia
taiwan
thailand
australia:
europe:
austria
denmark
finland
france
germany
greece
ireland
italy
netherlands
norway
poland
spain
sweden
ukraine
united kingdom
vatican
middle east:
iran
iraq
israel
kuwait
israel-lebanon
lebanon
palestinian authority
saudi arabia
syria
turkey
yemen
state:
city:
albuquerque nm
anchorage ak
atlanta ga
austin tx
baltimore md
boston ma
buffalo ny
charleston-huntington wv
chicago il
cincinnati oh
dallas - ft worth tx
denver co
des moines ia
detroit mi
houston tx
indianapolis in
kansas city mo
las vegas nv
little rock ar
los angeles ca
louisville ky
memphis tn
miami fl
milwaukee wi
minneapolis-st paul mn
nashville tn
new orleans la
new york city ny
orlando fl
philadelphia pa
phoenix az
pittsburgh pa
portland or
raleigh-durham nc
richmond va
st. Louis mo
san antonio tx
seattle wa
tampa fl
washington dc
business:
business:
apple
rim-blackberry
google
kmart-sears
merck
microsoft
wal-mart
back to top |
| ( Read More... | 23600 bytes more | comments? | ) |
| |
| Water Wisdom: Ecology and life in Green Lake |
| Posted on Friday, June 26 @ 00:02:41 PDT (6 reads) | |
|
|
“there and back again.”
– tolkien, the hobbit.
at one time or another, everyone has commuted: perhaps to school or to a job. There are exceptions. For example, you may work on a farm or from your home, or perhaps you were homeschooled.
if your commute to grade, middle and high school was like mine, it was uphill, both ways, in the snow. Then again, many animals commute or migrate during their life. Birds such as canada geese, robins and sandhill cranes have returned from the south weeks ago and monarch butterflies have started their journey north from the hills of mexico. In the fall, these animals will mirror that trip and return south. The migration patterns of antelope and wildebeest across the great plains of africa also are well known.
but let us call our attention to summertime green lake. What’s in a sample of that water? I want to focus on the smallest of the animals; these are called “zooplankton.” The zoo part comes from the greek and refers to them being animals; the plankton part (planktos) also comes from the greek and means wanderer.
this is the same root word that gives us ‘planet’ — to the ancient greeks, the planets, unlike the stars, seemed to be wandering about the heavens. Zooplankton in green lake range in size from less than 1/50th of an inch to about 1/8th of an inch. For me, metric units are easier to deal with: their size ranges from about 0.5 to 3 millimeters.
these tiny animals commute on a daily basis for their livelihood. A concentrated sample from a local lake will contain hundreds of individuals comprising several species. The photograph top right is an example of what you might find. The animals in focus are caught in the water’s surface tension and are floating on the surface; those fuzzy bits out of the plane of focus are zooplankton still freely swimming in the water.
because they wander up and down, we need to take our sample at the right time of day and in the right place.
the type of zooplankton in the photograph belong to a group of arthropods called “cladocerans.” These are the favorite food of small fish and that gives us a clue as to why they commute.
they stay in deeper water during the day; a haunt where the fish cannot see them. Then just before the sun dips below the horizon, they begin their commute upwards. By the time they reach the upper water the sun has set, and the water is dark enough so they can avoid visual predators. Zooplankton feed on algae in the upper waters and then, just before sunrise, they begin their commute down.
because this vertical up and down occurs on a 24-hour cycle, it is called a “diel vertical migration (dvm).” The origin of the term diel is derived from latin, dies, meaning day. The dvm phenomenon is seen in the ocean, but many more kinds of animals are involved, including fish. The same driving force — avoiding larger visual predators — is in action here.
if you want to capture zooplankton, you can build your own net, but remember that zooplankton are small so you will need some nylon bolting made with a mesh size small enough to capture your quarry (
your net may be fashioned so that a wire loop holds the netting open; the hanger part is then attached to a pole, like a fish net. Or you can fashion it so that you can attach it to a long line that can be tossed into the water.
the result should look like a windsock. A google search will show you how to do this. Alternatively, plankton nets are available from scientific supply houses for less than $70. The skill of tossing a net will take some practice to avoid tangling the line. Because the plankton net will concentrate the sample, if you take too much of a sample, the net will become clogged. The joy for you and your children might come from sampling different habitats: lakes vs. Ponds vs. Marshes and shorelines vs. Deep waters. However, remember that shorelines can be treacherous; avoid places where the land is unstable or steep. A false step can lead to a tumble and injury.
you need not sample in the middle of the night to collect zooplankton. Daytime collections provide a rich array of species. Two warnings. First, don’t let go of the line when you toss the net! I’ve seen students do that. Second, make sure the net is securely attached to the line! I once lost the net because of a failed knot.
enjoy the summer!
robert l. Wallace, ph.D. Is a professor biology, emeritus, at ripon college and a member of the green lake association science and technology committee. |
| ( Read More... | 9018 bytes more | comments? | ) |
| |
| Who Are Alexi Lalas Parents? All About Demetrios Lalas and Anne Harding Woodwort |
| Posted on Friday, June 26 @ 00:02:41 PDT (7 reads) | |
|
|
Alexi lalas became one of american soccer’s most recognizable faces during the 1990s. His trademark beard, strong defending, and outspoken personality made him unforgettable. Yet behind his success stood two influential parents who shaped his character long before professional soccer came into the picture. Their guidance, education, and support helped build the foundation for his remarkable journey.
watch what’s trending now!
who is alexi lalas’ father, demetrios (dimitrios) lalas?
demetrios, sometimes spelled dimitrios lalas, is alexi lalas’ father. He was born in greece and later built an academic career. Demetrios worked as a professor, earning respect through education and research. His professional achievements reflected a deep commitment to learning and intellectual growth.
growing up, alexi witnessed his father’s disciplined approach toward work. Education always carried significant importance in the lalas’ household. Demetrios encouraged curiosity, critical thinking, and dedication. Those values stayed with alexi throughout his playing and broadcasting career.
the family’s greek heritage also came largely through demetrios. Alexi often embraced that side of his identity publicly. His full name, panayotis alexander lalas, reflects those strong greek roots. Even after becoming famous, he remained proud of that connection.
demetrios reportedly emphasized earning a college degree despite soccer opportunities. Years later, alexi completed his education at rutgers university. That achievement carried special meaning because it fulfilled the expectations his parents had established years earlier.
who is alexi lalas’ mother, anne harding woodworth?
anne harding woodworth is alexi lalas’ mother. She built her reputation as an accomplished american poet and writer. Her work reflected creativity, thoughtful expression, and a deep appreciation for language.
while demetrios represented academic structure, she brought artistic influence to family life. Alexi grew up surrounded by books, ideas, and conversations. Those experiences likely contributed to his confidence as a communicator today.
hello, sunshine. Happy mother’s day, especially to all the soccer moms. 396 days until the world cup returns. What are we yelling about?
[pic.Twitter.Com/4w2jykotal]— alexi lalas (@alexilalas)
[may 11, 2025]
her impact extended beyond literature. Anne encouraged education and personal development. She supported her son’s ambitions while ensuring academics remained important. When alexi left rutgers to pursue soccer, the value of finishing school never disappeared.
years later, after professional soccer and executive positions, alexi returned. He completed his degree in english with a minor in music. That accomplishment reflected lessons learned from both parents. Their influence remained strong even decades later.
what are alexi lalas’ parents’ ethnicity and nationality?
alexi lalas comes from a multicultural family background. His father, demetrios lalas, is greek by nationality and ethnicity. His mother, anne harding woodworth, is american.
this blend of greek and american heritage shaped alexi’s upbringing. He grew up appreciating both cultures and traditions. The influence remained visible throughout his life and career.
alexi speaks multiple languages, including greek, english, italian, and spanish. His connection to greece remained especially important. He often acknowledged that heritage while representing the united states internationally.
how did alexi lalas’ parents influence his football career?
alexi’s soccer journey didn’t begin with pressure from home. Instead, his parents encouraged growth, education, and commitment. They supported his athletic dreams while stressing personal responsibility.
when his talent emerged during high school, they remained supportive. As opportunities expanded, they encouraged a balance between sports and academics. That mindset followed alexi to rutgers university.
even after leaving college for national team training, their lessons endured. The unfinished degree stayed in his mind for years. Eventually, he returned and graduated more than two decades later. That decision reflected more than academic achievement. It honors the values his parents taught him from childhood. Education mattered. Finishing what was started mattered too.
even today, alexi frequently publicly celebrates father’s day and mother’s day. Those tributes reveal lasting respect for both parents. Their influence reached beyond soccer fields and trophies. They helped shape the person behind the player.
written by
edited by
snehal dogra |
| ( Read More... | 9300 bytes more | comments? | ) |
| |
|
| Classifieds |
|
|
